ID: 1170102700

View in Genome Browser
Species Human (GRCh38)
Location 20:12720002-12720024
Sequence CAAGGTGGTCACATTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170102690_1170102700 7 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102700 20:12720002-12720024 CAAGGTGGTCACATTGGGATGGG No data
1170102689_1170102700 8 Left 1170102689 20:12719971-12719993 CCCAAAATTTACACGTTGAAGCT No data
Right 1170102700 20:12720002-12720024 CAAGGTGGTCACATTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170102700 Original CRISPR CAAGGTGGTCACATTGGGAT GGG Intergenic
No off target data available for this crispr