ID: 1170102701

View in Genome Browser
Species Human (GRCh38)
Location 20:12720005-12720027
Sequence GGTGGTCACATTGGGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170102690_1170102701 10 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102701 20:12720005-12720027 GGTGGTCACATTGGGATGGGAGG No data
1170102689_1170102701 11 Left 1170102689 20:12719971-12719993 CCCAAAATTTACACGTTGAAGCT No data
Right 1170102701 20:12720005-12720027 GGTGGTCACATTGGGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170102701 Original CRISPR GGTGGTCACATTGGGATGGG AGG Intergenic
No off target data available for this crispr