ID: 1170102702

View in Genome Browser
Species Human (GRCh38)
Location 20:12720013-12720035
Sequence CATTGGGATGGGAGGTAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170102696_1170102702 -9 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102702 20:12720013-12720035 CATTGGGATGGGAGGTAATTAGG No data
1170102690_1170102702 18 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102702 20:12720013-12720035 CATTGGGATGGGAGGTAATTAGG No data
1170102697_1170102702 -10 Left 1170102697 20:12720000-12720022 CCCAAGGTGGTCACATTGGGATG No data
Right 1170102702 20:12720013-12720035 CATTGGGATGGGAGGTAATTAGG No data
1170102689_1170102702 19 Left 1170102689 20:12719971-12719993 CCCAAAATTTACACGTTGAAGCT No data
Right 1170102702 20:12720013-12720035 CATTGGGATGGGAGGTAATTAGG No data
1170102695_1170102702 -8 Left 1170102695 20:12719998-12720020 CCCCCAAGGTGGTCACATTGGGA No data
Right 1170102702 20:12720013-12720035 CATTGGGATGGGAGGTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170102702 Original CRISPR CATTGGGATGGGAGGTAATT AGG Intergenic
No off target data available for this crispr