ID: 1170107552

View in Genome Browser
Species Human (GRCh38)
Location 20:12767900-12767922
Sequence GACTTTCCCCCACCGCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170107550_1170107552 -1 Left 1170107550 20:12767878-12767900 CCATCACTCTGCCAGAGGGACTG No data
Right 1170107552 20:12767900-12767922 GACTTTCCCCCACCGCCTCAAGG No data
1170107549_1170107552 0 Left 1170107549 20:12767877-12767899 CCCATCACTCTGCCAGAGGGACT No data
Right 1170107552 20:12767900-12767922 GACTTTCCCCCACCGCCTCAAGG No data
1170107546_1170107552 10 Left 1170107546 20:12767867-12767889 CCTGTTCAGGCCCATCACTCTGC No data
Right 1170107552 20:12767900-12767922 GACTTTCCCCCACCGCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170107552 Original CRISPR GACTTTCCCCCACCGCCTCA AGG Intergenic
No off target data available for this crispr