ID: 1170107772

View in Genome Browser
Species Human (GRCh38)
Location 20:12770255-12770277
Sequence CGAATGGTAGTTCTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170107772_1170107774 -2 Left 1170107772 20:12770255-12770277 CCTGAAGACAGAACTACCATTCG No data
Right 1170107774 20:12770276-12770298 CGACCCAGCAATACCATTACTGG No data
1170107772_1170107775 -1 Left 1170107772 20:12770255-12770277 CCTGAAGACAGAACTACCATTCG No data
Right 1170107775 20:12770277-12770299 GACCCAGCAATACCATTACTGGG 0: 72
1: 6080
2: 21667
3: 11986
4: 10795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170107772 Original CRISPR CGAATGGTAGTTCTGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr