ID: 1170107774

View in Genome Browser
Species Human (GRCh38)
Location 20:12770276-12770298
Sequence CGACCCAGCAATACCATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170107772_1170107774 -2 Left 1170107772 20:12770255-12770277 CCTGAAGACAGAACTACCATTCG No data
Right 1170107774 20:12770276-12770298 CGACCCAGCAATACCATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170107774 Original CRISPR CGACCCAGCAATACCATTAC TGG Intergenic
No off target data available for this crispr