ID: 1170107775

View in Genome Browser
Species Human (GRCh38)
Location 20:12770277-12770299
Sequence GACCCAGCAATACCATTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50600
Summary {0: 72, 1: 6080, 2: 21667, 3: 11986, 4: 10795}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170107772_1170107775 -1 Left 1170107772 20:12770255-12770277 CCTGAAGACAGAACTACCATTCG No data
Right 1170107775 20:12770277-12770299 GACCCAGCAATACCATTACTGGG 0: 72
1: 6080
2: 21667
3: 11986
4: 10795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170107775 Original CRISPR GACCCAGCAATACCATTACT GGG Intergenic
Too many off-targets to display for this crispr