ID: 1170115863

View in Genome Browser
Species Human (GRCh38)
Location 20:12858864-12858886
Sequence GTGGCTATGTAAGGGCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170115855_1170115863 17 Left 1170115855 20:12858824-12858846 CCCAGAGTTAAGGGAGTGGTGAG No data
Right 1170115863 20:12858864-12858886 GTGGCTATGTAAGGGCACACAGG No data
1170115856_1170115863 16 Left 1170115856 20:12858825-12858847 CCAGAGTTAAGGGAGTGGTGAGA No data
Right 1170115863 20:12858864-12858886 GTGGCTATGTAAGGGCACACAGG No data
1170115853_1170115863 23 Left 1170115853 20:12858818-12858840 CCATTGCCCAGAGTTAAGGGAGT No data
Right 1170115863 20:12858864-12858886 GTGGCTATGTAAGGGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170115863 Original CRISPR GTGGCTATGTAAGGGCACAC AGG Intergenic
No off target data available for this crispr