ID: 1170116812

View in Genome Browser
Species Human (GRCh38)
Location 20:12869280-12869302
Sequence GCCATGATGCAGGACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170116806_1170116812 30 Left 1170116806 20:12869227-12869249 CCACAGACAATGACTTCAGCTTG No data
Right 1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG No data
1170116809_1170116812 -6 Left 1170116809 20:12869263-12869285 CCATTTAGAGTTGGCAAGCCATG No data
Right 1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170116812 Original CRISPR GCCATGATGCAGGACATGGA AGG Intergenic
No off target data available for this crispr