ID: 1170116971

View in Genome Browser
Species Human (GRCh38)
Location 20:12871007-12871029
Sequence ATTCCCAGTGGACCACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170116971_1170116973 7 Left 1170116971 20:12871007-12871029 CCAGTGTGTGGTCCACTGGGAAT No data
Right 1170116973 20:12871037-12871059 CACTGAGACTTATTCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170116971 Original CRISPR ATTCCCAGTGGACCACACAC TGG (reversed) Intergenic
No off target data available for this crispr