ID: 1170117216

View in Genome Browser
Species Human (GRCh38)
Location 20:12873225-12873247
Sequence CCTCATTTGCTGATGGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170117216_1170117222 5 Left 1170117216 20:12873225-12873247 CCTGCTACCATCAGCAAATGAGG No data
Right 1170117222 20:12873253-12873275 GAATGATTCCAGCTATGAACTGG No data
1170117216_1170117226 30 Left 1170117216 20:12873225-12873247 CCTGCTACCATCAGCAAATGAGG No data
Right 1170117226 20:12873278-12873300 TCCTGGCAGGTTTGAATTCTAGG No data
1170117216_1170117225 17 Left 1170117216 20:12873225-12873247 CCTGCTACCATCAGCAAATGAGG No data
Right 1170117225 20:12873265-12873287 CTATGAACTGGACTCCTGGCAGG No data
1170117216_1170117224 13 Left 1170117216 20:12873225-12873247 CCTGCTACCATCAGCAAATGAGG No data
Right 1170117224 20:12873261-12873283 CCAGCTATGAACTGGACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170117216 Original CRISPR CCTCATTTGCTGATGGTAGC AGG (reversed) Intergenic
No off target data available for this crispr