ID: 1170117445

View in Genome Browser
Species Human (GRCh38)
Location 20:12875643-12875665
Sequence TGGAATAAATGCAGCAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170117445_1170117449 27 Left 1170117445 20:12875643-12875665 CCTCCTTTGCTGCATTTATTCCA No data
Right 1170117449 20:12875693-12875715 CTGCAGAAGGCCTAGTGCACAGG No data
1170117445_1170117448 14 Left 1170117445 20:12875643-12875665 CCTCCTTTGCTGCATTTATTCCA No data
Right 1170117448 20:12875680-12875702 TGAGTTTCTTTAACTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170117445 Original CRISPR TGGAATAAATGCAGCAAAGG AGG (reversed) Intergenic
No off target data available for this crispr