ID: 1170117448

View in Genome Browser
Species Human (GRCh38)
Location 20:12875680-12875702
Sequence TGAGTTTCTTTAACTGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170117446_1170117448 11 Left 1170117446 20:12875646-12875668 CCTTTGCTGCATTTATTCCAGAG No data
Right 1170117448 20:12875680-12875702 TGAGTTTCTTTAACTGCAGAAGG No data
1170117445_1170117448 14 Left 1170117445 20:12875643-12875665 CCTCCTTTGCTGCATTTATTCCA No data
Right 1170117448 20:12875680-12875702 TGAGTTTCTTTAACTGCAGAAGG No data
1170117447_1170117448 -6 Left 1170117447 20:12875663-12875685 CCAGAGCTGCATGACTGTGAGTT No data
Right 1170117448 20:12875680-12875702 TGAGTTTCTTTAACTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170117448 Original CRISPR TGAGTTTCTTTAACTGCAGA AGG Intergenic
No off target data available for this crispr