ID: 1170118350

View in Genome Browser
Species Human (GRCh38)
Location 20:12885622-12885644
Sequence ACAACCCAGAAGGGTAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170118350_1170118355 0 Left 1170118350 20:12885622-12885644 CCTGCCTTACCCTTCTGGGTTGT No data
Right 1170118355 20:12885645-12885667 AAGGTGCTTTACTAAGCTCTTGG No data
1170118350_1170118356 20 Left 1170118350 20:12885622-12885644 CCTGCCTTACCCTTCTGGGTTGT No data
Right 1170118356 20:12885665-12885687 TGGTACTAGCCCAACCAGAATGG No data
1170118350_1170118357 28 Left 1170118350 20:12885622-12885644 CCTGCCTTACCCTTCTGGGTTGT No data
Right 1170118357 20:12885673-12885695 GCCCAACCAGAATGGTTCCCTGG No data
1170118350_1170118359 29 Left 1170118350 20:12885622-12885644 CCTGCCTTACCCTTCTGGGTTGT No data
Right 1170118359 20:12885674-12885696 CCCAACCAGAATGGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170118350 Original CRISPR ACAACCCAGAAGGGTAAGGC AGG (reversed) Intergenic
No off target data available for this crispr