ID: 1170118799

View in Genome Browser
Species Human (GRCh38)
Location 20:12890512-12890534
Sequence AATTGTGGATGTTCATGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170118797_1170118799 -4 Left 1170118797 20:12890493-12890515 CCAGGTAAACATGTAAACAAATT No data
Right 1170118799 20:12890512-12890534 AATTGTGGATGTTCATGCAATGG No data
1170118793_1170118799 28 Left 1170118793 20:12890461-12890483 CCAAAATCTGGAAACAACCCAAA 0: 5
1: 172
2: 994
3: 3087
4: 6387
Right 1170118799 20:12890512-12890534 AATTGTGGATGTTCATGCAATGG No data
1170118795_1170118799 11 Left 1170118795 20:12890478-12890500 CCCAAACGTCTATCACCAGGTAA No data
Right 1170118799 20:12890512-12890534 AATTGTGGATGTTCATGCAATGG No data
1170118796_1170118799 10 Left 1170118796 20:12890479-12890501 CCAAACGTCTATCACCAGGTAAA No data
Right 1170118799 20:12890512-12890534 AATTGTGGATGTTCATGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170118799 Original CRISPR AATTGTGGATGTTCATGCAA TGG Intergenic
No off target data available for this crispr