ID: 1170119260

View in Genome Browser
Species Human (GRCh38)
Location 20:12894135-12894157
Sequence GCTGATATGCAGAGTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170119260_1170119264 -1 Left 1170119260 20:12894135-12894157 CCCTCAGCACTCTGCATATCAGC No data
Right 1170119264 20:12894157-12894179 CAACATGGGAAAAGCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170119260 Original CRISPR GCTGATATGCAGAGTGCTGA GGG (reversed) Intergenic
No off target data available for this crispr