ID: 1170121431

View in Genome Browser
Species Human (GRCh38)
Location 20:12916761-12916783
Sequence TTGAAGCCTCTTTTGCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170121431_1170121435 17 Left 1170121431 20:12916761-12916783 CCAATTGGCAAAAGAGGCTTCAA No data
Right 1170121435 20:12916801-12916823 AGGCAAAGCAATTCAGATACTGG No data
1170121431_1170121433 -3 Left 1170121431 20:12916761-12916783 CCAATTGGCAAAAGAGGCTTCAA No data
Right 1170121433 20:12916781-12916803 CAATGGCTACAGAAAGCCTCAGG No data
1170121431_1170121437 22 Left 1170121431 20:12916761-12916783 CCAATTGGCAAAAGAGGCTTCAA No data
Right 1170121437 20:12916806-12916828 AAGCAATTCAGATACTGGCAGGG No data
1170121431_1170121436 21 Left 1170121431 20:12916761-12916783 CCAATTGGCAAAAGAGGCTTCAA No data
Right 1170121436 20:12916805-12916827 AAAGCAATTCAGATACTGGCAGG No data
1170121431_1170121439 30 Left 1170121431 20:12916761-12916783 CCAATTGGCAAAAGAGGCTTCAA No data
Right 1170121439 20:12916814-12916836 CAGATACTGGCAGGGGAATGTGG No data
1170121431_1170121438 23 Left 1170121431 20:12916761-12916783 CCAATTGGCAAAAGAGGCTTCAA No data
Right 1170121438 20:12916807-12916829 AGCAATTCAGATACTGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170121431 Original CRISPR TTGAAGCCTCTTTTGCCAAT TGG (reversed) Intergenic
No off target data available for this crispr