ID: 1170121434

View in Genome Browser
Species Human (GRCh38)
Location 20:12916797-12916819
Sequence TATCTGAATTGCTTTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170121434_1170121439 -6 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121439 20:12916814-12916836 CAGATACTGGCAGGGGAATGTGG No data
1170121434_1170121440 -5 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121440 20:12916815-12916837 AGATACTGGCAGGGGAATGTGGG No data
1170121434_1170121442 2 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121442 20:12916822-12916844 GGCAGGGGAATGTGGGCCCTGGG No data
1170121434_1170121443 17 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121443 20:12916837-12916859 GCCCTGGGCCCTGTGAACTGTGG No data
1170121434_1170121441 1 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121441 20:12916821-12916843 TGGCAGGGGAATGTGGGCCCTGG No data
1170121434_1170121449 26 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121449 20:12916846-12916868 CCTGTGAACTGTGGCTGCAAGGG No data
1170121434_1170121447 25 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121447 20:12916845-12916867 CCCTGTGAACTGTGGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170121434 Original CRISPR TATCTGAATTGCTTTGCCTG AGG (reversed) Intergenic
No off target data available for this crispr