ID: 1170121439

View in Genome Browser
Species Human (GRCh38)
Location 20:12916814-12916836
Sequence CAGATACTGGCAGGGGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170121431_1170121439 30 Left 1170121431 20:12916761-12916783 CCAATTGGCAAAAGAGGCTTCAA No data
Right 1170121439 20:12916814-12916836 CAGATACTGGCAGGGGAATGTGG No data
1170121434_1170121439 -6 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121439 20:12916814-12916836 CAGATACTGGCAGGGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170121439 Original CRISPR CAGATACTGGCAGGGGAATG TGG Intergenic
No off target data available for this crispr