ID: 1170121439 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:12916814-12916836 |
| Sequence | CAGATACTGGCAGGGGAATG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170121434_1170121439 | -6 | Left | 1170121434 | 20:12916797-12916819 | CCTCAGGCAAAGCAATTCAGATA | No data | ||
| Right | 1170121439 | 20:12916814-12916836 | CAGATACTGGCAGGGGAATGTGG | No data | ||||
| 1170121431_1170121439 | 30 | Left | 1170121431 | 20:12916761-12916783 | CCAATTGGCAAAAGAGGCTTCAA | No data | ||
| Right | 1170121439 | 20:12916814-12916836 | CAGATACTGGCAGGGGAATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170121439 | Original CRISPR | CAGATACTGGCAGGGGAATG TGG | Intergenic | ||