ID: 1170121447

View in Genome Browser
Species Human (GRCh38)
Location 20:12916845-12916867
Sequence CCCTGTGAACTGTGGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170121434_1170121447 25 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121447 20:12916845-12916867 CCCTGTGAACTGTGGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170121447 Original CRISPR CCCTGTGAACTGTGGCTGCA AGG Intergenic
No off target data available for this crispr