ID: 1170121449

View in Genome Browser
Species Human (GRCh38)
Location 20:12916846-12916868
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170121434_1170121449 26 Left 1170121434 20:12916797-12916819 CCTCAGGCAAAGCAATTCAGATA No data
Right 1170121449 20:12916846-12916868 CCTGTGAACTGTGGCTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170121449 Original CRISPR CCTGTGAACTGTGGCTGCAA GGG Intergenic
No off target data available for this crispr