ID: 1170121829

View in Genome Browser
Species Human (GRCh38)
Location 20:12920650-12920672
Sequence ATGGTAAAACATATCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170121829_1170121832 -10 Left 1170121829 20:12920650-12920672 CCCTGTGGGATATGTTTTACCAT 0: 1
1: 0
2: 4
3: 14
4: 183
Right 1170121832 20:12920663-12920685 GTTTTACCATCTTCATTTGGAGG 0: 1
1: 0
2: 1
3: 17
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170121829 Original CRISPR ATGGTAAAACATATCCCACA GGG (reversed) Intergenic
907839750 1:58145225-58145247 ATGGTAGCACAGATCCCTCATGG + Intronic
910120866 1:83788872-83788894 ATGTTAAAAGATATCCAACTGGG + Intergenic
910140322 1:84020171-84020193 ATGATAAAACATATCCTTAAAGG - Intergenic
910971205 1:92857695-92857717 ATGGTAATACCTATTCCATAGGG - Intronic
911169495 1:94756207-94756229 TTGATAAAACATATTCCAAAAGG + Intergenic
912363965 1:109117613-109117635 ATGGTAATACCTATCTCACAGGG + Intronic
913056747 1:115169182-115169204 ATTTCAAAACATTTCCCACAGGG + Intergenic
921529305 1:216261018-216261040 ATGGTAAAACATTTCCAAAATGG - Intronic
921582192 1:216907905-216907927 ATGTTAAAACATATTCCACAGGG + Intronic
922226869 1:223653021-223653043 AAGTTAAAACATCTCCAACAAGG + Intronic
922708703 1:227809273-227809295 ATGGAAAAAAATATTCAACACGG + Intergenic
923537952 1:234867525-234867547 ATGGAAAACCATATGCCACCAGG + Intergenic
923571536 1:235119606-235119628 ATGGACAACAATATCCCACAAGG + Intronic
924124178 1:240832894-240832916 GTAGTAAAACATATCCCCCCAGG - Intronic
924354666 1:243159244-243159266 AGTGGAAAACATATCACACATGG + Intronic
1064778075 10:18802295-18802317 ATGGAATAATATATTCCACAGGG + Intergenic
1065054175 10:21826788-21826810 ATGGTCAAACATGTTCAACAAGG - Intronic
1065346810 10:24756358-24756380 TTGGAAGAACATATCACACAAGG - Intergenic
1066021475 10:31307979-31308001 ATGGGAAAACAGATTCAACAAGG + Intergenic
1067400217 10:45966010-45966032 ATGTTAATACATATGACACAGGG + Intergenic
1067868544 10:49935298-49935320 ATGTTAATACATATGACACAGGG + Intronic
1068234434 10:54215249-54215271 ATGTTAAAACACATCCAAAAAGG + Intronic
1074405149 10:113175077-113175099 AAGGTAAAACATATCCCATTTGG - Intergenic
1077917364 11:6620076-6620098 ATGGTAACTCAAAGCCCACAAGG + Intergenic
1078347443 11:10563280-10563302 ATGATAAAGCATATCTCATAGGG + Intronic
1080250106 11:30224416-30224438 ATTGTAAAACATATATCACATGG + Intergenic
1080400818 11:31934098-31934120 ATGGTTAAAAATACCCCACCAGG + Intronic
1080782201 11:35440040-35440062 GTTCTAAAACATAGCCCACATGG + Intronic
1080819238 11:35789443-35789465 ATGTAAAAACATATAGCACATGG - Intronic
1081304520 11:41495364-41495386 TTGGTAAAAAATATCTCAAATGG + Intergenic
1085058378 11:73421894-73421916 ATGGTAAAGTATATACCACTTGG - Intronic
1085484956 11:76855036-76855058 ATGGTACAACATATCTCATATGG + Intergenic
1085853651 11:80151289-80151311 ACAATAAAACATATCTCACAAGG - Intergenic
1086418130 11:86610072-86610094 ATGTTTAAACATATGCCAAAAGG + Intronic
1086644033 11:89196790-89196812 AAGGGAAAACCTACCCCACAAGG + Intronic
1090458805 11:126871681-126871703 ATGCTCAAACAAATGCCACAAGG - Intronic
1090685230 11:129109848-129109870 TTTGTAAATGATATCCCACAAGG - Intronic
1094248094 12:28326292-28326314 ATAATAAAAAATATCCCAAATGG - Intronic
1095519923 12:43051419-43051441 TTCGTAAAACCTATGCCACAGGG + Intergenic
1096388101 12:51208495-51208517 ATGGTGAAACAAAGCCCAGAGGG + Intronic
1096816809 12:54206938-54206960 GAGATAAAACATATGCCACAGGG + Intergenic
1097659156 12:62409148-62409170 ATCGGGAAACATACCCCACACGG + Intronic
1098909791 12:76197140-76197162 ATGGTAAAACCATCCCCACAGGG - Intergenic
1099004345 12:77218453-77218475 ATGGTAAAACATGGCCCACAAGG - Intergenic
1099283979 12:80692116-80692138 CTGGAACAAGATATCCCACAGGG + Intergenic
1099778888 12:87169083-87169105 ATGCCAAAACATTTCCCTCAAGG - Intergenic
1099884348 12:88508729-88508751 ATGGTAAAACATATCTCCCATGG - Intronic
1099916193 12:88896547-88896569 ATAGTAAAAAATATGCCTCATGG - Intergenic
1100668347 12:96780745-96780767 TTGATAAAAAATATCCCAGATGG + Intronic
1104090687 12:125514582-125514604 ATGGTAACACTTTCCCCACATGG - Intronic
1104528200 12:129544330-129544352 ATGCTAAAACAAATTCCAAATGG - Intronic
1107388608 13:39940318-39940340 ATGGTAAAACACATGGCACTTGG - Intergenic
1108826512 13:54418405-54418427 AAGTTAAAACAAATGCCACATGG + Intergenic
1109653297 13:65355898-65355920 GTTGTAGAACAAATCCCACATGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110417085 13:75264797-75264819 ATGTTAAAACCTAACCCCCATGG - Intergenic
1117467246 14:56005749-56005771 ATGATAAACCACATCCCACGAGG - Intergenic
1119119109 14:72056980-72057002 ATACAAAAATATATCCCACAAGG - Intronic
1119462235 14:74816393-74816415 ATGGGACAACATCTACCACATGG - Intronic
1121847010 14:97180772-97180794 ATGGAAAAGCGTGTCCCACACGG + Intergenic
1124873880 15:33572532-33572554 ATGGCAAAACAGCTCCAACAGGG - Intronic
1125584589 15:40811051-40811073 ATGGAAAAACCTACCTCACAGGG + Intronic
1127326791 15:57903637-57903659 AGGTTAAAATACATCCCACATGG - Intergenic
1128504936 15:68261561-68261583 ATTTTGAAACATATCCCCCAAGG + Intergenic
1133710645 16:8397926-8397948 ATGATAACACCTATCCCTCATGG - Intergenic
1135799139 16:25476258-25476280 ATGGTAAGACATGCCCCAGATGG + Intergenic
1135868400 16:26126458-26126480 ATTGTAACACATATCTCAGAAGG - Intronic
1137571665 16:49570313-49570335 ATGGTAACACCCATCTCACATGG - Intronic
1140837606 16:78809703-78809725 AGGGTCAAACAAAGCCCACATGG - Intronic
1141166350 16:81663666-81663688 ATTGTAACAAATATCCCACAGGG + Intronic
1146450650 17:32971480-32971502 CTGGTAAAAGATACCCCAGAAGG + Intronic
1146716746 17:35092484-35092506 TTGGTAAAATATATGCCTCAGGG - Intronic
1146825279 17:36017254-36017276 AATCTAATACATATCCCACAGGG + Intronic
1147759239 17:42787079-42787101 ATGGTAAGATTTATCCCACAAGG + Intronic
1150313300 17:64147022-64147044 TTGGTAAAAGATCTTCCACAAGG + Intergenic
1152990677 18:361096-361118 ATGATGAAAAATAGCCCACAAGG - Intronic
1153535039 18:6092741-6092763 AGGTTAAAAAATATCACACAAGG + Intronic
1154253030 18:12759856-12759878 AAGGTAAAACAAAACCCAAAGGG + Intergenic
1154467879 18:14667484-14667506 ATGCCAAACCATTTCCCACAGGG + Intergenic
1157542982 18:48525239-48525261 ATGATAATACACATCACACAGGG + Intergenic
1162463726 19:10828948-10828970 CTGGAAAAACATCTCTCACAGGG - Intronic
1163666277 19:18605519-18605541 ACGGTCACACACATCCCACAGGG - Intronic
1165526187 19:36356923-36356945 GTGGTAAAACATATCTGACAAGG - Intronic
927360474 2:22226507-22226529 ATAGTCAAACATTTTCCACAAGG - Intergenic
928318701 2:30266437-30266459 CAGGTAAAAAATAACCCACAGGG + Intronic
931554660 2:63489109-63489131 ATGGTATATCAAATCCCACATGG + Intronic
935201900 2:100864172-100864194 AAGATAAAAGGTATCCCACATGG - Intronic
937624912 2:124033505-124033527 ATGGTAATACACAAACCACATGG - Intronic
939271837 2:139949148-139949170 ATGGTATAACAAATCCAACAGGG + Intergenic
939949637 2:148454570-148454592 ATATTAAAACATAACCCAGAAGG + Intronic
940108426 2:150124361-150124383 CTGGTCCCACATATCCCACAAGG + Intergenic
940517672 2:154700286-154700308 ATGCTAAAACAAATTGCACATGG + Intronic
941403220 2:165057472-165057494 ATGGTAAAAAATTACTCACAAGG - Intergenic
941925956 2:170894987-170895009 TTGTGAAAACATATCCCACGTGG - Intergenic
942235700 2:173902685-173902707 GTGGTAAAACAAGTCCCAGAAGG + Intergenic
942395426 2:175542530-175542552 ATGGTAAAACAAATTCATCAAGG - Intergenic
942995667 2:182257038-182257060 AGGGTAAATCAAATGCCACAGGG - Intronic
943111087 2:183606854-183606876 ATGGAAAAAAATACCTCACAAGG + Intergenic
943242914 2:185409636-185409658 ATAACAAAACATATCTCACATGG - Intergenic
943503853 2:188728479-188728501 ATGGAGAAACACATCCCAAAAGG + Intergenic
945838358 2:214858855-214858877 ATGTTAAAAAAAACCCCACATGG - Intergenic
948152163 2:235752958-235752980 ATGCAAACACATATCCCACTAGG - Intronic
1170121829 20:12920650-12920672 ATGGTAAAACATATCCCACAGGG - Intergenic
1170609222 20:17898430-17898452 ATTGTAAAACATTTCTAACACGG + Intergenic
1172561649 20:35894033-35894055 ATAGTAAAAGATGTCCCAAAAGG + Intronic
1172995705 20:39069155-39069177 AAGGAAAATCAGATCCCACAGGG - Intergenic
1173083401 20:39891433-39891455 ATGGTAATACGTACCCCATAGGG - Intergenic
1174317006 20:49711426-49711448 ATGGAAAACTATATCCCACTGGG - Intronic
1175346959 20:58286530-58286552 AAGGTAGAACACATGCCACAAGG - Intergenic
1176806633 21:13490169-13490191 ATGCCAAACCATTTCCCACAGGG - Intergenic
1178549938 21:33528336-33528358 CTGGAAAAACATAATCCACATGG + Intronic
949622054 3:5824508-5824530 AAGGTAAAACATATCACTCTAGG - Intergenic
953649163 3:44784487-44784509 ATGGTAATAAATATCACATAGGG - Intronic
955120417 3:56052648-56052670 ATAGTAACACCTATCCCAGAAGG + Intronic
956057702 3:65318081-65318103 ATGGTACTACATATTCCACAGGG + Intergenic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
957367538 3:79245736-79245758 ATGATAAAGCATTTCCCCCAAGG - Intronic
959316514 3:104814680-104814702 ATAGAAAAACAAATACCACATGG + Intergenic
960124754 3:113986350-113986372 ATGGCATAACAAATCCCATAAGG + Intronic
960391717 3:117084931-117084953 ATAGTAAAAGATGTCCCTCATGG - Intronic
965714255 3:171585995-171586017 TTGATAAAACATATTCCAAAGGG + Intergenic
967389422 3:188941008-188941030 ATGCTCAGACATATCCCAAAAGG - Intergenic
967445226 3:189557893-189557915 GTGCTGAAACATATCCCCCATGG - Intergenic
967749344 3:193095796-193095818 ATTGTGAGACATTTCCCACAGGG + Intergenic
967957171 3:194886253-194886275 AGGCAAAAACACATCCCACATGG + Intergenic
968336813 3:197920587-197920609 ATAGTAAAACACATGCCACCAGG - Intronic
970463593 4:16300983-16301005 ATGGTAACAAATATCCCATCTGG + Intergenic
979247140 4:118520406-118520428 AGTGGAAAACATATCACACATGG - Intergenic
979414693 4:120421810-120421832 ATGGAAAAACATTTGACACATGG - Intergenic
980138445 4:128885059-128885081 ATTGTAAAACATATTCCAGATGG + Intronic
980405422 4:132348255-132348277 ATCATAGAACATATCCCAGAAGG + Intergenic
980897226 4:138871673-138871695 ATGGAAAATCACATTCCACATGG + Intergenic
981776161 4:148370079-148370101 ATGGTAAAAGTTGTCCCATAGGG + Intronic
982626758 4:157777095-157777117 TTGGTAAACCATGGCCCACATGG + Intergenic
986353897 5:6905540-6905562 CTGGTAAAACATATCCCTCAGGG - Intergenic
987877720 5:23700755-23700777 CTGGTAAAACATATTTTACAAGG + Intergenic
987918132 5:24242651-24242673 ATGTTAAAACTTAACCCACAAGG - Intergenic
988630530 5:32926471-32926493 ATCTTTAAACATATCCCTCACGG + Intergenic
990025441 5:51181775-51181797 ATAATAAAATGTATCCCACAGGG + Intergenic
991321858 5:65383110-65383132 ATGTTAAAACCTAACCCTCAAGG - Intronic
993593927 5:89829049-89829071 ATAGTGAAACATAACCTACAGGG + Intergenic
995728548 5:115209835-115209857 AGGGTAAAACCTAACACACAGGG - Intergenic
996027770 5:118667900-118667922 ATGTTAAAAGATATTCCTCAGGG - Intergenic
998121779 5:139584308-139584330 ATGGTATAACCTAGGCCACATGG - Intronic
998948927 5:147372045-147372067 ATGGTAACACATGTCAGACATGG - Intronic
1000753547 5:165128082-165128104 AAGTTAGAACATTTCCCACATGG - Intergenic
1000972310 5:167727897-167727919 ATGGTAATATTTATCCCAAAAGG - Intronic
1001614172 5:173029095-173029117 ATAGAAAAACAGCTCCCACAGGG - Intronic
1002153572 5:177257011-177257033 ATGGTAAAACTTTCCACACAAGG - Exonic
1003690484 6:8348793-8348815 ATGAGAAAACATATACCAGATGG + Intergenic
1003757666 6:9140067-9140089 ATGTTAAAAGATAACCCTCAGGG + Intergenic
1004255022 6:14055643-14055665 CTGGTAAAACAAGTCCCCCAAGG - Intergenic
1004614584 6:17278627-17278649 AATGTAAAACAAAACCCACAGGG + Intergenic
1005427508 6:25717938-25717960 ATGGTAATACCTACCTCACAGGG - Intergenic
1009487059 6:64237922-64237944 ATAGTAAAACAAATCATACAAGG + Intronic
1010742725 6:79527196-79527218 CTGGTAAAACAGACCCCAGAAGG + Intronic
1011430222 6:87278130-87278152 GTGATAATACATATCTCACAGGG - Intergenic
1014354607 6:120390246-120390268 ATGGTTAATGATATCCTACATGG + Intergenic
1015051187 6:128842361-128842383 GTGGTAAAACAATTCACACAAGG + Intergenic
1015386161 6:132626385-132626407 ATATTAAAACATCTCCCACAAGG - Intergenic
1015715771 6:136190883-136190905 CTTGAAAAAGATATCCCACAGGG + Intronic
1017543971 6:155431740-155431762 AAGGTAATACATATGCCTCATGG - Intronic
1019444694 7:1065234-1065256 AAGGTAAAACGTACCCCACTTGG + Intronic
1023555192 7:41414865-41414887 ATTGTAAAATATATCTCACTGGG - Intergenic
1023801115 7:43835412-43835434 ATGGTAAAACACGGCCAACATGG + Intergenic
1027485122 7:78752004-78752026 AAGGAAGAACATATACCACAGGG + Intronic
1027581507 7:80002527-80002549 ATGGTAAAACTGAGCCAACATGG + Intergenic
1027827070 7:83129193-83129215 ACAATAAAACCTATCCCACAGGG + Intronic
1027906533 7:84191532-84191554 ATTGTATCACATATCCCAAATGG + Intronic
1031190302 7:118540621-118540643 AGGATAAAACATACCCTACATGG - Intergenic
1031500920 7:122515089-122515111 ATTGTAAAACATCACCCAAATGG + Intronic
1037226455 8:16597522-16597544 ATGGGAATCCATATTCCACATGG + Intergenic
1037831790 8:22194225-22194247 ATGGTAAAACAACTCCCTCCTGG + Intronic
1038882054 8:31625764-31625786 ATGTTAAGACATAACCCCCAAGG + Intergenic
1038983455 8:32783952-32783974 ATGGAAAAACATTTCCCTCTTGG + Intergenic
1041137168 8:54772600-54772622 ATGATACAACCTATCCCATAGGG - Intergenic
1044949365 8:97420147-97420169 GGGGAAAAACATGTCCCACAAGG - Intergenic
1047991344 8:130289813-130289835 ATTATACAACATACCCCACAGGG + Intronic
1049139488 8:140939739-140939761 ATGGTAAATCATTTCGCAAAAGG + Intronic
1049913809 9:296927-296949 ATGGAAAATCAGAACCCACATGG - Intronic
1051087433 9:13366163-13366185 TTGGTATAACATATCCTCCATGG + Intergenic
1052038114 9:23706200-23706222 ACGGTATACCAAATCCCACAAGG + Intronic
1052349383 9:27442929-27442951 ATACTAACACTTATCCCACAGGG - Intronic
1052521767 9:29557213-29557235 AAGGTACAACAAATCCCAGAAGG + Intergenic
1054883967 9:70175643-70175665 ATCTTAGAACATATCCCTCAAGG + Intronic
1055090082 9:72354978-72355000 ATGGAAAATCATAACCAACATGG - Exonic
1055488052 9:76776379-76776401 ATGGAAAATCAGATACCACATGG - Intronic
1055788189 9:79893431-79893453 ATGGCAAAACTCATCCCAGATGG - Intergenic
1059091455 9:111363528-111363550 TTTCTAAAACATATGCCACATGG + Intronic
1060492178 9:124093029-124093051 ATGGCAGAACATGGCCCACAAGG + Intergenic
1062133104 9:134910782-134910804 TTGGTAAAGAATGTCCCACAAGG + Intronic
1188715431 X:33454655-33454677 ATGGAAAAACATTCCACACAAGG + Intergenic
1190713459 X:53085422-53085444 CTTGTAAAACATATTCCACTGGG - Intronic
1192082338 X:68060419-68060441 AGGGTAAATCATACCTCACAAGG + Intronic
1193511932 X:82412869-82412891 ATCGTAAAACTTAATCCACAAGG - Intergenic
1193576633 X:83206766-83206788 ATGGCAAATCATTTTCCACATGG - Intergenic
1194275302 X:91872797-91872819 ATGGTCAAACATATGGCAAAAGG + Intronic
1196981773 X:121222217-121222239 ATGATAAAAAATATCTCACTGGG - Intergenic
1199214802 X:145251824-145251846 ATGGCCAAAAGTATCCCACAAGG + Intronic
1200592547 Y:5094194-5094216 ATGGTCAAACATATGGCAAAAGG + Intronic
1201642137 Y:16191374-16191396 ATAGGAAAAAAGATCCCACAGGG + Intergenic
1201660678 Y:16393947-16393969 ATAGGAAAAAAGATCCCACAGGG - Intergenic