ID: 1170124788

View in Genome Browser
Species Human (GRCh38)
Location 20:12950592-12950614
Sequence CCCTTTTAAAGCACCTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170124782_1170124788 -6 Left 1170124782 20:12950575-12950597 CCCAGCTTTTGGCCCCACCCTTT 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 168
1170124777_1170124788 15 Left 1170124777 20:12950554-12950576 CCCAGCTGTTCTGACTCTGCCCC No data
Right 1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 168
1170124783_1170124788 -7 Left 1170124783 20:12950576-12950598 CCAGCTTTTGGCCCCACCCTTTT 0: 1
1: 0
2: 4
3: 14
4: 187
Right 1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 168
1170124780_1170124788 -4 Left 1170124780 20:12950573-12950595 CCCCCAGCTTTTGGCCCCACCCT 0: 1
1: 0
2: 2
3: 39
4: 308
Right 1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 168
1170124778_1170124788 14 Left 1170124778 20:12950555-12950577 CCAGCTGTTCTGACTCTGCCCCC 0: 1
1: 1
2: 2
3: 35
4: 401
Right 1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 168
1170124781_1170124788 -5 Left 1170124781 20:12950574-12950596 CCCCAGCTTTTGGCCCCACCCTT 0: 1
1: 0
2: 1
3: 29
4: 280
Right 1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 168
1170124776_1170124788 16 Left 1170124776 20:12950553-12950575 CCCCAGCTGTTCTGACTCTGCCC No data
Right 1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170124788 Original CRISPR CCCTTTTAAAGCACCTTCAG AGG Intergenic
900779429 1:4608084-4608106 CCCTTTCCCAGAACCTTCAGAGG - Intergenic
900909419 1:5584375-5584397 CCCATTCAAACCACATTCAGTGG + Intergenic
901532924 1:9864694-9864716 CCTTTGCAAAGCACCATCAGAGG + Intronic
902500481 1:16907864-16907886 CCCTATTAAAGCGCCTTCCTTGG + Intronic
903029453 1:20452369-20452391 GCCTTTTAAAGCATATGCAGAGG + Intergenic
903187732 1:21638800-21638822 CCCTTTTCCATCACCTTGAGAGG + Intronic
904725088 1:32540591-32540613 CCCTCCTAAGGCACCTCCAGAGG + Intronic
904864769 1:33569734-33569756 GCATTTTAAATAACCTTCAGGGG - Intronic
906635918 1:47410438-47410460 CCCTGCTAAAACACCTCCAGTGG - Intergenic
908011320 1:59780221-59780243 CTCTTTTAAAAACCCTTCAGTGG - Intergenic
908083674 1:60607858-60607880 CCCTTTTAAAGAACCTGCTGTGG + Intergenic
908786613 1:67740733-67740755 CCCTTATAAAGCAGGTTCAAGGG + Intronic
910200838 1:84697067-84697089 CCCTATTTAAGAACCTTCAATGG + Intergenic
910678084 1:89834990-89835012 CCCTTCTCAAGAACCTTCAATGG - Intronic
910781753 1:90944195-90944217 CCCATTTAAAGCAACTTCATTGG + Intronic
915735700 1:158083551-158083573 CCCTGCTCAAGCACCTTCAATGG - Intronic
918179161 1:182070957-182070979 CACTGTTTCAGCACCTTCAGTGG + Intergenic
919794543 1:201313412-201313434 AGCTTTTACAGCACCTGCAGTGG + Exonic
921294692 1:213690856-213690878 CCCTTTTATAGCTCCTTCAGTGG - Intergenic
922656975 1:227393755-227393777 TCCTTTCCTAGCACCTTCAGAGG + Intergenic
923428194 1:233892654-233892676 CCCATGTAAAGCTCTTTCAGTGG - Intergenic
923517097 1:234707103-234707125 CCCTTTTAAAGCTCCACAAGGGG - Intergenic
1065352096 10:24804772-24804794 CCCTTTTAAAGGATCTGCAGAGG + Intergenic
1065773550 10:29099624-29099646 TGCTTTTAAATCACCTGCAGAGG + Intergenic
1066928112 10:41723093-41723115 ACTTTTTAAAGAATCTTCAGTGG + Intergenic
1067540661 10:47149925-47149947 CCCTTGTAAAATTCCTTCAGTGG + Intergenic
1068755663 10:60649667-60649689 CTCTCCTAAGGCACCTTCAGGGG - Intronic
1073463945 10:103682939-103682961 ACCTTTTAAAGCAATTTCCGAGG - Intronic
1074191148 10:111138885-111138907 CTGTTATAAATCACCTTCAGGGG - Intergenic
1087605805 11:100376617-100376639 CCTTTTCAAAGCAACTTCAATGG - Intergenic
1087972871 11:104507258-104507280 CCCTTTTAATGAATCTTCAAGGG + Intergenic
1088176951 11:107064422-107064444 CTCTTTTAAAATACCTTCAATGG + Intergenic
1089215627 11:116832956-116832978 CCCTTTTAAGCAACCTACAGGGG - Exonic
1089834564 11:121358568-121358590 CCCATGGAAATCACCTTCAGGGG + Intergenic
1089892792 11:121898202-121898224 TCCTTTTCAAAAACCTTCAGCGG - Intergenic
1090139610 11:124241484-124241506 CTCTTTTAAACCCTCTTCAGTGG + Intergenic
1090958471 11:131535002-131535024 GAATTTTAAAACACCTTCAGTGG - Intronic
1092390399 12:8072249-8072271 CCCTTTTGAAGTACCTACAATGG + Intergenic
1101266555 12:103094263-103094285 CCCTATTAAAACACTTTGAGTGG + Intergenic
1102033835 12:109759828-109759850 CGCTTTCCAAGCACCTTCGGTGG + Intronic
1107723336 13:43272768-43272790 CATTTTTAAAACACCTTCACAGG + Intronic
1108505363 13:51108027-51108049 CCCTTCACCAGCACCTTCAGAGG - Intergenic
1109940041 13:69349787-69349809 CCCTTTTAAAATACCTTTAAAGG + Intergenic
1110933926 13:81259174-81259196 CCCTTTTAACTCACTTTAAGAGG + Intergenic
1112399653 13:99064902-99064924 CCCTTATAAACCACCAGCAGAGG - Intronic
1113041194 13:106105543-106105565 CATTTCTCAAGCACCTTCAGTGG + Intergenic
1113816436 13:113174782-113174804 CCCTTTTAAAACATCATCACAGG - Intergenic
1115247105 14:31307022-31307044 CCATTTTAAATCAACTCCAGAGG + Intronic
1115252503 14:31364246-31364268 TCCTTTGAAAACACCGTCAGTGG - Exonic
1118865521 14:69700403-69700425 CCCTTCTCAAGAACCTTCAGCGG + Intronic
1119340207 14:73870478-73870500 CCCTTTTAAAGCTGCTTAAGAGG - Intronic
1121303678 14:92891565-92891587 CCCTTCTGAAGCAACTTCAGGGG + Intergenic
1121313045 14:92945492-92945514 CCCTTGTAAAGCATCTGCTGTGG - Intronic
1124212683 15:27776437-27776459 CCCTGCTTAATCACCTTCAGAGG + Intronic
1126982671 15:54262640-54262662 TCCTTTTAAATCATCTTTAGTGG + Intronic
1127149983 15:56063619-56063641 TTCTTTTTAAGCTCCTTCAGTGG - Intergenic
1127830498 15:62746311-62746333 CGCTTTTAAAGTACCTCCTGGGG - Intronic
1128219354 15:65957383-65957405 CCCTTTGAGAACAGCTTCAGGGG + Intronic
1128232833 15:66047671-66047693 ACCTTTTCAAGCAGCTTCACTGG - Intronic
1129624542 15:77182856-77182878 CCCTATTCAAGACCCTTCAGTGG - Intronic
1130984650 15:88837015-88837037 CCCCTTTAGAGCACATTCTGGGG + Intronic
1134565227 16:15246195-15246217 CCCTTTGCAAGCACCTTCCATGG - Intergenic
1134737269 16:16510503-16510525 CCCTTTGCAAGCACCTTCCATGG + Intergenic
1138134644 16:54511165-54511187 CCCTGTTAAAGTACAGTCAGAGG + Intergenic
1140102819 16:71933074-71933096 CCCTGTTAATGCACTTTCAAGGG + Intronic
1141764079 16:86047177-86047199 CCCTGTTCAAACACCTTCTGAGG - Intergenic
1144595490 17:16567005-16567027 CCCTCAGAAAGTACCTTCAGAGG - Intronic
1146476930 17:33170465-33170487 CTCTCCTAAAGCACCATCAGTGG - Intronic
1148192112 17:45686573-45686595 CCCTTTGAAAGCACCTTAAGTGG + Intergenic
1148679103 17:49463086-49463108 CCCTTTTCAACAACCTTCAGTGG + Intronic
1148687552 17:49509187-49509209 CCCGTTTTCAGCACCTTCTGAGG - Intronic
1148752496 17:49953276-49953298 CCCTCTTAAACCACCTTCCTTGG - Intergenic
1152049321 17:77959546-77959568 CCCTTTTAAAACTCATGCAGCGG + Intergenic
1156914327 18:42447663-42447685 GCCTTTTAAAGCAGCTGCAGGGG - Intergenic
1157570209 18:48707214-48707236 TCCTTTAAAAGCACATACAGTGG - Intronic
1159409888 18:68058086-68058108 TTCTTTTTAAGCACCTTCTGAGG + Intergenic
1164891083 19:31824194-31824216 CCCTTTTCAAGGATCTTCTGTGG - Intergenic
1166434127 19:42752778-42752800 CCCTTTAAATGCACATTCTGTGG - Intronic
925288479 2:2730902-2730924 CCCTTCCAAAGCTCCTTCAAGGG + Intergenic
925320742 2:2965482-2965504 GACTTTAAAAGAACCTTCAGAGG + Intergenic
926942332 2:18151703-18151725 CCCTTCCCCAGCACCTTCAGAGG + Intronic
931439522 2:62278354-62278376 ACCTGTTACAGCAGCTTCAGGGG + Intergenic
931851529 2:66256060-66256082 CCGTTTTAAAAGACCTCCAGAGG + Intergenic
933262654 2:80147566-80147588 CCCTTGTAAATCACTTTTAGGGG + Intronic
933632849 2:84675976-84675998 CCGTCTTAAAGCAGCTTTAGTGG - Intronic
935888249 2:107648218-107648240 TACTTTTAAAAGACCTTCAGAGG + Intergenic
939032462 2:137092946-137092968 CTTTTTTAAACCACATTCAGAGG + Intronic
939389714 2:141550847-141550869 TCCTTTCAAAGCACTTTAAGTGG - Intronic
939694264 2:145304752-145304774 CCCTTTTAAAGAACAATGAGGGG - Intergenic
940402837 2:153267212-153267234 GCCTGTGAAAGCAGCTTCAGGGG - Intergenic
941447772 2:165623867-165623889 CCCTTTTAGAGCAGCTGCAAGGG + Intronic
942712952 2:178859037-178859059 ACCTTATAAATCATCTTCAGTGG - Intronic
944083839 2:195821220-195821242 CTTTTTTAAAGCACCTTTGGAGG + Intronic
945138964 2:206663255-206663277 CCCTGTTGAAGCATCTTCAGTGG + Exonic
945823579 2:214694248-214694270 CCATCTTCAAGCACCTACAGGGG - Intergenic
1170123478 20:12936190-12936212 CCCCCTTAAAGCACCTTCAGAGG + Intergenic
1170124788 20:12950592-12950614 CCCTTTTAAAGCACCTTCAGAGG + Intergenic
1173228627 20:41177022-41177044 CTCATTTAAATCACCTTGAGAGG - Intronic
1179269463 21:39839559-39839581 ACATTATAAAGCACCTGCAGAGG + Intergenic
1181470573 22:23136847-23136869 ACCTTTTAAAGCACCTTGCCTGG + Intronic
1182180330 22:28340248-28340270 CAGTTGTAAAGCACCTTAAGAGG - Intronic
1183737748 22:39653320-39653342 CCCTTATAAAGCAGCTCCAGGGG + Intronic
1185131625 22:49042744-49042766 CTCCTTAAAAGCACCCTCAGTGG - Intergenic
949852781 3:8435748-8435770 CCCTTCTCTAGCACCTTCAGAGG + Intergenic
950745990 3:15089572-15089594 ACCATTTAAAGCAAATTCAGTGG + Intronic
951207541 3:19940281-19940303 CCCTGAGAAAGCACCATCAGAGG + Intronic
951454679 3:22877081-22877103 TTCTTTTAAAGCATCTTCTGCGG - Intergenic
952852186 3:37738538-37738560 CCCTTTTCAAAAACTTTCAGTGG - Intronic
952953861 3:38544696-38544718 CCCTTGTAAACCAACTTCATAGG - Intergenic
954698959 3:52441818-52441840 CCCTTTGCCAGCACCTTCATAGG - Exonic
954845432 3:53551671-53551693 CCCTTCTCAAGAACCTTCACTGG + Intronic
955572366 3:60321829-60321851 CCTTCTTGAAGCATCTTCAGTGG + Intronic
957356903 3:79100682-79100704 CCATTTGAAAGCATGTTCAGGGG + Intronic
957521770 3:81327669-81327691 CCCTTCTAAACCATTTTCAGTGG - Intergenic
965247765 3:166296711-166296733 CTCTATTTAAGCACCTTCACTGG - Intergenic
966247083 3:177820991-177821013 CACTTTCAAAGCATTTTCAGGGG + Intergenic
967182373 3:186917533-186917555 CCCTTTTAAAGCACTTTACATGG + Intergenic
973646193 4:52953524-52953546 CCCCTTGACACCACCTTCAGGGG - Intronic
973899834 4:55457532-55457554 CCCTGCTAAAAAACCTTCAGTGG + Intronic
977428297 4:96898402-96898424 CCCTTTTAATACATGTTCAGTGG - Intergenic
978683556 4:111413148-111413170 CTCTTGTAAAGCAGATTCAGTGG + Intergenic
981411940 4:144442402-144442424 GCCTGTGAAAGCAGCTTCAGGGG - Intergenic
984172951 4:176382864-176382886 TCCTTTTAAAACAAATTCAGAGG - Intergenic
984772391 4:183448026-183448048 CCCGCTTAAAGAATCTTCAGCGG - Exonic
985910122 5:2872763-2872785 CACTGTTAAAACACCTCCAGAGG - Intergenic
986098955 5:4587484-4587506 ACCTTTTCAATCACCTTAAGAGG + Intergenic
987117234 5:14735614-14735636 CCCTTCCCTAGCACCTTCAGAGG - Intronic
987516865 5:18921188-18921210 CCCTTTCCAAGAAACTTCAGGGG - Intergenic
988191003 5:27934662-27934684 ACCTTTCAAAGCTACTTCAGTGG + Intergenic
988415370 5:30940572-30940594 CCCATTTTAAACACCTTTAGGGG - Intergenic
990189580 5:53243956-53243978 CCCTTTCAAAGAACGTTAAGTGG - Intergenic
994119317 5:96096133-96096155 TCCTTTTAGGGCAGCTTCAGAGG - Intergenic
994250901 5:97535997-97536019 CCCTATTAAAGAATCCTCAGTGG - Intergenic
995637412 5:114209387-114209409 CCTTTTTAAAGCATTTTCATTGG + Intergenic
1001543183 5:172553390-172553412 TCCTGCTCAAGCACCTTCAGTGG - Intergenic
1002026009 5:176396767-176396789 TCCTGTTCAAACACCTTCAGTGG + Intronic
1002351539 5:178587162-178587184 CCTATTTAAAGCACTTTAAGAGG + Intronic
1002509930 5:179708177-179708199 GGCATTTAAAGGACCTTCAGAGG + Intronic
1003223210 6:4180294-4180316 TCCTTCTGTAGCACCTTCAGAGG + Intergenic
1004288289 6:14343196-14343218 CCCTTTACAAGCAGATTCAGAGG + Intergenic
1004801192 6:19150326-19150348 CCCATTTATTGCACCTTCATAGG - Intergenic
1006419531 6:33924609-33924631 CCTTTTCAAATCACCTCCAGTGG - Intergenic
1007905185 6:45452936-45452958 CCCTTCCAAAGCACCATCACTGG + Intronic
1008465965 6:51830955-51830977 CCATTTTAAAGCTGATTCAGGGG + Exonic
1016666709 6:146650745-146650767 CCATTTCAAAGCACCCTCAGAGG + Intronic
1017055694 6:150433852-150433874 CCTTTTTAAATCCCCTTCAAGGG - Intergenic
1019412733 7:913632-913654 GCCATTAAAAGCTCCTTCAGAGG + Intronic
1019797724 7:3064180-3064202 CTCCTTTAAAGCTCCCTCAGGGG - Intergenic
1022232345 7:28426396-28426418 CCCTTTTCAAGAACCTTCACTGG + Intronic
1022632563 7:32099314-32099336 CCATTATAAAGAACCTTCAGGGG + Intronic
1024790403 7:52959174-52959196 CTGTTTAAAAGCACCTTAAGTGG + Intergenic
1028065118 7:86375020-86375042 CTCTTTTAAACCACTTTCATTGG + Intergenic
1028216386 7:88138984-88139006 CTCTGTAAAAGCACCCTCAGGGG - Intronic
1029287424 7:99475481-99475503 CCCCTTTAGAACACTTTCAGAGG + Intronic
1030318060 7:108136660-108136682 TCTTTTTCCAGCACCTTCAGAGG + Intergenic
1030688735 7:112511560-112511582 TCCTTCTCTAGCACCTTCAGAGG - Intergenic
1033852831 7:145517948-145517970 AACTTTTAAAGCATCTTCGGTGG + Intergenic
1035050924 7:155998729-155998751 CCTTTTTAAAGAACATTGAGTGG - Intergenic
1036584975 8:10115430-10115452 TCCTTTCCTAGCACCTTCAGAGG + Intronic
1038005878 8:23429910-23429932 CACTTTTAAACCTCCTCCAGGGG - Exonic
1038931039 8:32193923-32193945 CCCTTCTCTAGCACCTGCAGAGG + Intronic
1039581915 8:38673919-38673941 CCCTTTCAAAGCACACACAGGGG + Intergenic
1039758218 8:40545688-40545710 CCCTTCTCTTGCACCTTCAGAGG + Intronic
1041729436 8:61050109-61050131 CCCTTTTACAGCCTCATCAGTGG + Intergenic
1043277838 8:78422469-78422491 TCCTTTCCTAGCACCTTCAGAGG + Intergenic
1044531935 8:93317022-93317044 CCTGTTGAAAACACCTTCAGAGG - Intergenic
1048143473 8:131818536-131818558 CCCTATTAAGGTACCTTCAATGG + Intergenic
1049038016 8:140091713-140091735 CCCTTTGAAGCCAACTTCAGAGG - Intronic
1050327806 9:4514704-4514726 CCAGCTTAAAGCCCCTTCAGTGG - Intronic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1051423164 9:16908954-16908976 TCCCTCTCAAGCACCTTCAGTGG - Intergenic
1056100894 9:83299755-83299777 CCCTTTAAAAGAACCCACAGTGG + Intronic
1061092431 9:128434150-128434172 CGCTTTGAGAGCAACTTCAGGGG + Exonic
1061778933 9:132984563-132984585 TCCTTTGAATGCACCTGCAGTGG + Intronic
1061989355 9:134149941-134149963 CCCTTTTCCAGCCTCTTCAGCGG - Intronic
1186274207 X:7922313-7922335 CCTTTGTAAAGCACCTTAAATGG + Intronic
1186890742 X:13957055-13957077 CCCTGCTACATCACCTTCAGTGG - Intergenic
1187394225 X:18906156-18906178 CCATTTTATAACACCTTCACTGG - Intronic
1188259656 X:28007963-28007985 CCCATTGAAAGCAGCTGCAGGGG - Intergenic
1189612181 X:42748926-42748948 CTATTGTAAAGCACATTCAGAGG + Intergenic
1189894885 X:45645187-45645209 CCCTTTTAGGACACTTTCAGTGG - Intergenic
1190435666 X:50422163-50422185 CTCTTCTAAATCACCTTCACTGG + Intronic
1193080563 X:77402202-77402224 CCATTTTAAGGCAGTTTCAGTGG + Intergenic
1196651761 X:118175124-118175146 CCATTTTACAACACCTCCAGTGG - Intergenic
1196763812 X:119224558-119224580 CTCTTTTAAAACACCTTCCCTGG - Intergenic
1200283576 X:154799822-154799844 CGCTCTGAAAGCCCCTTCAGAGG + Intronic