ID: 1170127840

View in Genome Browser
Species Human (GRCh38)
Location 20:12985693-12985715
Sequence CCCAGTTACCAGTTTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170127840_1170127852 28 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127852 20:12985744-12985766 GGACTTTGGGGACACAGTCTGGG No data
1170127840_1170127845 5 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127845 20:12985721-12985743 GATGATGAAAGTGGTATAAATGG No data
1170127840_1170127848 14 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127848 20:12985730-12985752 AGTGGTATAAATGGGGACTTTGG No data
1170127840_1170127850 16 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127850 20:12985732-12985754 TGGTATAAATGGGGACTTTGGGG No data
1170127840_1170127853 29 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127853 20:12985745-12985767 GACTTTGGGGACACAGTCTGGGG No data
1170127840_1170127849 15 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127849 20:12985731-12985753 GTGGTATAAATGGGGACTTTGGG No data
1170127840_1170127844 -4 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127844 20:12985712-12985734 TGGGGACTTGATGATGAAAGTGG No data
1170127840_1170127847 7 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127847 20:12985723-12985745 TGATGAAAGTGGTATAAATGGGG No data
1170127840_1170127846 6 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127846 20:12985722-12985744 ATGATGAAAGTGGTATAAATGGG No data
1170127840_1170127851 27 Left 1170127840 20:12985693-12985715 CCAACCTCAAACTGGTAACTGGG No data
Right 1170127851 20:12985743-12985765 GGGACTTTGGGGACACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170127840 Original CRISPR CCCAGTTACCAGTTTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr