ID: 1170128087

View in Genome Browser
Species Human (GRCh38)
Location 20:12988096-12988118
Sequence GGAGAAACTGGTTCCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170128087_1170128095 28 Left 1170128087 20:12988096-12988118 CCCTGGGTGGAACCAGTTTCTCC No data
Right 1170128095 20:12988147-12988169 GCTCTGCAGGTGAAATCTAAGGG No data
1170128087_1170128094 27 Left 1170128087 20:12988096-12988118 CCCTGGGTGGAACCAGTTTCTCC No data
Right 1170128094 20:12988146-12988168 TGCTCTGCAGGTGAAATCTAAGG No data
1170128087_1170128091 15 Left 1170128087 20:12988096-12988118 CCCTGGGTGGAACCAGTTTCTCC No data
Right 1170128091 20:12988134-12988156 TCTCCTCCATTCTGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170128087 Original CRISPR GGAGAAACTGGTTCCACCCA GGG (reversed) Intergenic
No off target data available for this crispr