ID: 1170128090

View in Genome Browser
Species Human (GRCh38)
Location 20:12988117-12988139
Sequence AGGAGAGAAAGATATGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170128090_1170128094 6 Left 1170128090 20:12988117-12988139 CCAGACTCATATCTTTCTCTCCT No data
Right 1170128094 20:12988146-12988168 TGCTCTGCAGGTGAAATCTAAGG No data
1170128090_1170128095 7 Left 1170128090 20:12988117-12988139 CCAGACTCATATCTTTCTCTCCT No data
Right 1170128095 20:12988147-12988169 GCTCTGCAGGTGAAATCTAAGGG No data
1170128090_1170128091 -6 Left 1170128090 20:12988117-12988139 CCAGACTCATATCTTTCTCTCCT No data
Right 1170128091 20:12988134-12988156 TCTCCTCCATTCTGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170128090 Original CRISPR AGGAGAGAAAGATATGAGTC TGG (reversed) Intergenic
No off target data available for this crispr