ID: 1170128094

View in Genome Browser
Species Human (GRCh38)
Location 20:12988146-12988168
Sequence TGCTCTGCAGGTGAAATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170128087_1170128094 27 Left 1170128087 20:12988096-12988118 CCCTGGGTGGAACCAGTTTCTCC No data
Right 1170128094 20:12988146-12988168 TGCTCTGCAGGTGAAATCTAAGG No data
1170128090_1170128094 6 Left 1170128090 20:12988117-12988139 CCAGACTCATATCTTTCTCTCCT No data
Right 1170128094 20:12988146-12988168 TGCTCTGCAGGTGAAATCTAAGG No data
1170128088_1170128094 26 Left 1170128088 20:12988097-12988119 CCTGGGTGGAACCAGTTTCTCCA No data
Right 1170128094 20:12988146-12988168 TGCTCTGCAGGTGAAATCTAAGG No data
1170128089_1170128094 15 Left 1170128089 20:12988108-12988130 CCAGTTTCTCCAGACTCATATCT No data
Right 1170128094 20:12988146-12988168 TGCTCTGCAGGTGAAATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170128094 Original CRISPR TGCTCTGCAGGTGAAATCTA AGG Intergenic
No off target data available for this crispr