ID: 1170133220

View in Genome Browser
Species Human (GRCh38)
Location 20:13045167-13045189
Sequence AACTGGGTGCTGGAATATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170133220_1170133224 4 Left 1170133220 20:13045167-13045189 CCTGCATATTCCAGCACCCAGTT 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1170133224 20:13045194-13045216 TCCAGATATGACAGAAGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 93
1170133220_1170133226 22 Left 1170133220 20:13045167-13045189 CCTGCATATTCCAGCACCCAGTT 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1170133226 20:13045212-13045234 GCAGGAAGTAAACAAACCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170133220 Original CRISPR AACTGGGTGCTGGAATATGC AGG (reversed) Intronic
900343748 1:2201024-2201046 AGCTGGGTCCTGGAAGGTGCAGG - Intronic
900923745 1:5690341-5690363 AACTTGGTGATGGAATTGGCTGG - Intergenic
905330129 1:37188976-37188998 AACTGGGATCTGAAATATGGGGG - Intergenic
907328641 1:53657313-53657335 ACTTGGGTGGTGGAATATACAGG - Intronic
912247650 1:107977602-107977624 AACTGGGTGATGGTACATGGGGG - Intergenic
915125555 1:153661118-153661140 AACTAGGTGCTGAAAAATACCGG - Intronic
915985768 1:160462583-160462605 AACTGGGTGTGGGAAGGTGCGGG + Intergenic
916161372 1:161918849-161918871 AACTGGTTTATGTAATATGCTGG + Intronic
916629834 1:166600477-166600499 AACTGTGTGCAGGAGGATGCTGG - Intergenic
916881078 1:169019854-169019876 AAAGTGGTGCTGGGATATGCAGG - Intergenic
920619268 1:207528072-207528094 TACTGGGTGCTGGCATTTGGAGG - Intronic
920621050 1:207546627-207546649 TACTGGGTGCTGGCATTTGGAGG - Intronic
920622828 1:207565196-207565218 TACTGGGTGCTGGCATTTGGAGG - Intronic
922050422 1:221984088-221984110 AACTGGGTGCTGGAGAAACCAGG + Intergenic
923688901 1:236174432-236174454 TGCTGGGTTCTGGAAGATGCGGG + Intronic
1065167898 10:22999989-23000011 ACCTAGTTCCTGGAATATGCAGG + Intronic
1065260271 10:23916645-23916667 ATCTGGGTGCTAGCATATGTAGG - Intronic
1068331265 10:55573329-55573351 AAGTGGCTGCTGGAATATAAGGG - Intronic
1072252241 10:93590869-93590891 GCCTGGGTGTTGGAATATCCAGG - Intronic
1072488126 10:95875544-95875566 AACTGGGTGTTGAAATAATCTGG - Exonic
1077392481 11:2306613-2306635 AAATGGTTTCTGGAAAATGCTGG + Intronic
1078523040 11:12078564-12078586 AACTCGGGGCTGGATGATGCAGG - Intergenic
1080792644 11:35535574-35535596 CACTGGGAGGTTGAATATGCAGG - Intergenic
1081225880 11:40521790-40521812 ACCTGGGAGCTGGAAATTGCAGG + Intronic
1081825083 11:46042318-46042340 AACTGGGAGCTAGAATTTGACGG + Intronic
1082081250 11:48013950-48013972 AGGTGGGTTCTGGAATGTGCAGG + Intronic
1082119472 11:48362945-48362967 AACTGGTTGGTGCAATATGGTGG + Intergenic
1082254830 11:50022217-50022239 AACTGGTTGGTGCAATATGATGG - Intergenic
1083110062 11:60397423-60397445 TACTGAGTGCTGGAAAATGTGGG + Intronic
1084312886 11:68326935-68326957 AACTGGGTGTTGACATCTGCAGG - Intronic
1085186467 11:74580011-74580033 AACTGAAGGCTGGAATCTGCAGG - Intronic
1089784818 11:120900411-120900433 TATTGGGTGCTGCTATATGCTGG + Intronic
1095638915 12:44464591-44464613 AACAGGATGCTGGAATCTGCTGG - Intergenic
1108253530 13:48589612-48589634 AACTGGTTGCTGGAATTTAGGGG + Intergenic
1108560945 13:51643415-51643437 AACTGGCTGGAGGAATATGGTGG + Intronic
1109167218 13:59051366-59051388 AACTGGGGGCTTTAAAATGCTGG - Intergenic
1109327460 13:60885550-60885572 AACTGGGTCCTGCAAAGTGCTGG + Intergenic
1109883273 13:68510088-68510110 AACAGGGAGCTGGAAAATTCAGG - Intergenic
1114535327 14:23418859-23418881 AAATGGGTCCTGGGATTTGCAGG - Intronic
1116696434 14:48183548-48183570 ATCTGGGATCTGGAGTATGCAGG - Intergenic
1117820652 14:59645326-59645348 ATTGGGCTGCTGGAATATGCAGG - Intronic
1118251225 14:64163477-64163499 ATGTGGGTGCTGGACTCTGCGGG - Exonic
1118690237 14:68331603-68331625 AACTGGGTTCTGCAATTTCCTGG + Intronic
1121033259 14:90677096-90677118 AATTGGGTGTTGGGAAATGCAGG - Intronic
1121326385 14:93022335-93022357 AACGGGGTGCTGGCTAATGCTGG + Intronic
1123704916 15:22944436-22944458 AACTGGTTGCTTTAATTTGCAGG + Intronic
1125331953 15:38591347-38591369 AACTGGTTGCTGGAATTTGGGGG - Intergenic
1126527718 15:49676069-49676091 AACTGGGTCTTGGGATATTCAGG + Intergenic
1127511310 15:59644474-59644496 TACTGTGTGCTAGACTATGCTGG + Intronic
1128223210 15:65982949-65982971 AAATGGGAGCTGGAATGGGCTGG - Intronic
1129906744 15:79193099-79193121 AGCTGGGTTCTAGAATAAGCTGG + Intergenic
1130411080 15:83649292-83649314 AGCTGGGTGGTGGTATATGGTGG - Intergenic
1132496170 16:264477-264499 AACTGGGGGCTGGCATTTGGGGG + Intronic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1141355100 16:83338307-83338329 AACTGTCAGCTGTAATATGCCGG + Intronic
1147488958 17:40846001-40846023 ATCTGGGTGCAAGAATATACTGG + Intergenic
1148500335 17:48085586-48085608 AATTGGTTTCTGGAATATGAAGG + Intronic
1149387348 17:56155155-56155177 GACTGGAAGCTGGAAAATGCTGG + Intronic
1152596628 17:81240858-81240880 ACTTGGGTGCTGGCATATGGTGG - Intronic
1153454252 18:5262423-5262445 AACAGAGTGCTGGCAGATGCAGG - Intergenic
1154430249 18:14303148-14303170 AACTGGGGTCTGGAAAATGGTGG - Intergenic
1156110834 18:33725111-33725133 CACTGGGTGCTTGATCATGCAGG + Intronic
1156349051 18:36287369-36287391 AACTGGGTGGGGAAAGATGCAGG - Intergenic
1157258377 18:46157965-46157987 GACTGGGTGCTGGAATTGGGGGG + Intergenic
1159475825 18:68920045-68920067 ACCTGGGTGATGAAATATCCTGG - Intronic
1163385129 19:16995267-16995289 AACTGGGTGCAGACAGATGCAGG + Intronic
1164056525 19:21626680-21626702 AACTGTGAGCTGGCATAAGCCGG - Intergenic
1165155926 19:33787574-33787596 AGTGGGGTGCTGGAATGTGCTGG - Intergenic
925715272 2:6779335-6779357 AACTGGAGGTTGGAAAATGCTGG - Intergenic
936495728 2:113019198-113019220 AACTGAGTGTTGGAATGTGCAGG + Intergenic
937438863 2:121900419-121900441 AACTGGGGGTTGGATGATGCAGG + Intergenic
939806843 2:146784422-146784444 CACTGGGTGCTGGACTTTGTAGG + Intergenic
940761695 2:157745628-157745650 GACTGGGGGCAGGAATATGGAGG - Intronic
941561893 2:167057180-167057202 ATCTGGGTCCTGAAACATGCCGG - Intronic
942428681 2:175886134-175886156 AACTGTGGGCTTGAATAAGCAGG - Intergenic
942642755 2:178076822-178076844 AACTGGCAGCTGGGATGTGCTGG + Intronic
945471096 2:210228730-210228752 AACTGAATGCTGGAATCCGCTGG + Intergenic
947312462 2:228819009-228819031 TTCTGTGTGCTGGAATATGGAGG - Intergenic
1169642362 20:7768245-7768267 AACTGGGGACTGGAATATTCTGG - Intergenic
1170133220 20:13045167-13045189 AACTGGGTGCTGGAATATGCAGG - Intronic
1173284820 20:41660794-41660816 ACCTTGGGGCTGGAGTATGCTGG - Intergenic
1173749190 20:45463207-45463229 GACTGGGAGCTGGAATCAGCTGG + Intergenic
1179721921 21:43321090-43321112 GACTGGGTGCTGGAAGCTCCAGG - Intergenic
1180225724 21:46391030-46391052 ACCTGGGTCCTGGAAGCTGCTGG + Intronic
1181933977 22:26427134-26427156 AACTGGGTTCTGGAACAGGGAGG + Intergenic
1182915445 22:34025066-34025088 CACTGTGTGTTTGAATATGCTGG + Intergenic
1183450441 22:37891611-37891633 CACTGGGAGCTGGAAGAGGCAGG + Intergenic
949358736 3:3209220-3209242 AGCTGGGTGCTGGAAACAGCTGG + Intergenic
950262352 3:11552474-11552496 GACTGGGGGCTGGGATCTGCAGG - Intronic
950447362 3:13045977-13045999 AACTGGGTGTGGGAATGTTCTGG + Intronic
950469655 3:13176643-13176665 ATCTGGGTGCTTCAAGATGCCGG - Intergenic
951620420 3:24595487-24595509 AACTGGAGACTGGAATATACTGG + Intergenic
955041890 3:55325491-55325513 ATCTGGGTACTGGAATGTTCTGG - Intergenic
956924261 3:73966740-73966762 AACTGGGTTGTGGAATAACCTGG - Intergenic
958843690 3:99239897-99239919 AACTGGGTGCTCTGAAATGCTGG - Intergenic
959583234 3:108003090-108003112 AACAGGAAGCTGGAATATGAGGG - Intergenic
961399706 3:126630046-126630068 AAATGGGTGCTGGAGTCTGTAGG + Intronic
962876493 3:139539496-139539518 CACTGGGTACTGGAAGATGTTGG - Exonic
966014224 3:175121589-175121611 AACTGGATGTTGGAATTTCCTGG - Intronic
967488442 3:190061000-190061022 ATCTGGGTGATGGAATAGCCTGG - Intronic
974750964 4:66140380-66140402 AAGTGGGAGCTGGAATATATAGG - Intergenic
974902496 4:68018740-68018762 AACGTGGTGCTGGAATCTGCTGG + Intergenic
975655907 4:76641055-76641077 AACTGTGGGCTGAAATATACTGG + Intronic
976217574 4:82729481-82729503 AGCTGTGTGCTGGGAGATGCCGG - Intronic
976348459 4:84031939-84031961 AACTGGGTGCTGGAACTTAGTGG + Intergenic
979446650 4:120821475-120821497 ATCTGGGTGCTGAAAAAGGCAGG + Intronic
980233890 4:130078732-130078754 CACTGGCTATTGGAATATGCTGG - Intergenic
983221461 4:165047847-165047869 ACCTGCGTGCTGGAATACGGTGG - Intergenic
985719829 5:1483031-1483053 AACTGGGTACTGAAAGCTGCTGG + Intronic
986268945 5:6215117-6215139 AACTGGGTGATGGGGTATGCTGG - Intergenic
987747673 5:21997152-21997174 ACCTGTTTGCTGCAATATGCTGG - Intronic
988928587 5:36013775-36013797 TACTGGGTTCTGGAGGATGCTGG - Intergenic
989609438 5:43277203-43277225 CACTTGGTGATGGAGTATGCAGG + Exonic
991767851 5:70006945-70006967 ACCTGTTTGCTGCAATATGCTGG - Intergenic
991847085 5:70882023-70882045 ACCTGTTTGCTGCAATATGCTGG - Intergenic
991936743 5:71809674-71809696 ATCTGTGTGCTGGAATATAATGG - Intergenic
992598344 5:78369078-78369100 AACTGGTTGGTGGAATAGTCAGG + Intronic
996355506 5:122591933-122591955 AACTGGGTGCTGGAGAGTGAAGG - Intergenic
997359748 5:133287510-133287532 ACCTGGGTGCTGGCCTATGATGG + Intronic
997557863 5:134816937-134816959 AACTGGGTGTTTGTATATCCAGG - Intronic
999719003 5:154384953-154384975 TACTGAGGGCTTGAATATGCCGG - Intronic
1001000578 5:168002859-168002881 CACTGTGTGCTGAAATCTGCAGG + Intronic
1003310666 6:4967250-4967272 TTCTGGGTAGTGGAATATGCTGG - Intergenic
1004299385 6:14443649-14443671 AACTGTGTGTTGGGATATGGGGG - Intergenic
1007123258 6:39401253-39401275 AAATGGGAGCTGGATTATGCAGG - Intronic
1012613110 6:101240530-101240552 AACAGGATGCTGGAAGATACAGG + Intergenic
1015916615 6:138224028-138224050 ACCTGTGTGCTGGATTATTCAGG - Intronic
1017572430 6:155760819-155760841 AAATGGGTGCTAAAATCTGCTGG + Intergenic
1020389034 7:7639533-7639555 AACTGGTTGCTAGAATATCTGGG + Intronic
1021263255 7:18485291-18485313 AAGAAGGTGGTGGAATATGCTGG - Intronic
1022282681 7:28926973-28926995 CACTGGGTGCTGGAACGTGGAGG + Intergenic
1022340690 7:29464789-29464811 AACTGGGTGCTGGAAGCAGATGG - Intronic
1024352555 7:48381747-48381769 AACTGCCTGCTGGCTTATGCAGG - Intronic
1026118365 7:67515395-67515417 ACCTGGCTGGTGGAATTTGCAGG - Intergenic
1027770252 7:82397923-82397945 AACTGGGTGCTGGAACAGAATGG + Intronic
1032205017 7:129855939-129855961 AACTGGGTGCTGTGCTATGGAGG + Intronic
1036393553 8:8346880-8346902 AACTGCATGCTGGCATATGTGGG - Intronic
1037549478 8:19956538-19956560 ACCTGGGTGATGGAATATTCTGG - Intronic
1038024748 8:23578363-23578385 AACTGGGAACTGCCATATGCAGG - Intergenic
1038626720 8:29201097-29201119 AAGTGGGTGCTAAAATTTGCAGG - Intronic
1046642197 8:116744486-116744508 AAGTGGATGCTTAAATATGCTGG - Intronic
1053118464 9:35526259-35526281 TACTGAGTTCTGGAAGATGCTGG + Intronic
1056901996 9:90608564-90608586 AATTGGGTGCTGGAATTTGGGGG - Intergenic
1056907376 9:90665442-90665464 AGCTGGGTGCTGGCAGAGGCAGG + Intergenic
1057016675 9:91658223-91658245 AACTGAGTGCTGGAATGTCAGGG + Intronic
1057308031 9:93923814-93923836 AACTGGGAGGTGGAGTTTGCAGG + Intergenic
1058739989 9:107933365-107933387 CACTGGATGCTGGAATGTGGGGG - Intergenic
1059463252 9:114448777-114448799 ATCTGGGTGCTGGAATCATCTGG - Intronic
1062328368 9:136023526-136023548 GAGTGGGTGCTGGGATTTGCAGG - Intronic
1062448045 9:136603998-136604020 GTCTGGGTGCTGGGAGATGCAGG + Intergenic
1185566565 X:1099586-1099608 CACTGTGTGCTGGAATCAGCTGG + Intergenic
1186798455 X:13068921-13068943 AACTGGGGGCTGGGCTAGGCTGG - Intergenic
1188085618 X:25898325-25898347 AACTGTGAGCTGGCATAAGCCGG - Intergenic
1190876857 X:54466150-54466172 AACTGTGTGCTGGGTGATGCTGG + Intronic
1191634457 X:63360813-63360835 AACTGTGAGCTGGCATAAGCTGG + Intergenic
1196227578 X:113184681-113184703 AACTAGGGGCTAGATTATGCAGG + Intergenic
1197153304 X:123243751-123243773 GTCTGGGTGCTGAAATATGGTGG - Intronic
1198441394 X:136666826-136666848 AGCTGTGTGCTGGATTATTCAGG - Exonic
1199696958 X:150349395-150349417 AACTGGCTGCTTGAATTTCCAGG + Intergenic
1200293597 X:154894890-154894912 AGCTGGGTGCTGGAATCATCTGG - Intronic
1201648672 Y:16262713-16262735 AACTGGGTGCTGGTCTCTGGGGG + Intergenic
1201654137 Y:16322587-16322609 AACTGGGTGCTGGTCTCTGGGGG - Intergenic