ID: 1170137841

View in Genome Browser
Species Human (GRCh38)
Location 20:13094718-13094740
Sequence TTGTTCAAATGAAAAATCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 815
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 745}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170137837_1170137841 -1 Left 1170137837 20:13094696-13094718 CCCCCTTGTCTAACTCGTAGAGT 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG 0: 1
1: 0
2: 3
3: 66
4: 745
1170137840_1170137841 -4 Left 1170137840 20:13094699-13094721 CCTTGTCTAACTCGTAGAGTTGT 0: 1
1: 0
2: 0
3: 9
4: 72
Right 1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG 0: 1
1: 0
2: 3
3: 66
4: 745
1170137839_1170137841 -3 Left 1170137839 20:13094698-13094720 CCCTTGTCTAACTCGTAGAGTTG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG 0: 1
1: 0
2: 3
3: 66
4: 745
1170137838_1170137841 -2 Left 1170137838 20:13094697-13094719 CCCCTTGTCTAACTCGTAGAGTT 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG 0: 1
1: 0
2: 3
3: 66
4: 745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170137841 Original CRISPR TTGTTCAAATGAAAAATCTA TGG Intronic
900618525 1:3576419-3576441 TTGTTCAAATGAAATAATTTGGG + Intronic
900834518 1:4990022-4990044 TTATTCAGATGAAGAATCTCAGG + Intergenic
901364565 1:8735195-8735217 TTGTTACAATCTAAAATCTAAGG + Intronic
901588532 1:10318846-10318868 TTTTTCAAATTAACAACCTAAGG + Intronic
901682566 1:10922511-10922533 TGGTTCAAATGAAAACTGCAGGG + Intergenic
901976356 1:12947393-12947415 TTGTTCATATGAAAAAAAAAAGG + Intronic
901996493 1:13155760-13155782 TTGTTCATATGAAAAAAAAAAGG + Intergenic
902008816 1:13254377-13254399 TTGTTCATATGAAAAAAAAAAGG - Intronic
902155593 1:14482948-14482970 TTGTGCAGATGACAAAACTAAGG - Intergenic
902435181 1:16393826-16393848 TTTTTCAGATGAGAAAACTAAGG - Intronic
902720232 1:18299266-18299288 CTGTTCAAATGAAAAAAATAAGG + Intronic
903256517 1:22105636-22105658 TTTTTCAAATGAGAAAACCAAGG - Intergenic
903911453 1:26729456-26729478 TTTTTCAAATGACAAAATTAGGG + Intronic
904516791 1:31062036-31062058 TTTTACAAATGAAAACACTAAGG + Intronic
905102356 1:35535524-35535546 TTTTACACATGAAAAAACTAAGG - Intronic
905526006 1:38640267-38640289 TTTTTCAGATGAAGAAACTAAGG + Intergenic
905841548 1:41184291-41184313 TTTTACAAATGAAGAATGTAGGG + Intronic
906115501 1:43354007-43354029 TTTTACAGATGAAAAAACTAAGG - Intergenic
906871588 1:49487753-49487775 TTTTAAAAATGAAAAACCTATGG + Intronic
906925839 1:50115478-50115500 TTTTTCAAATGAAGAGTCCAAGG - Intronic
907113496 1:51948930-51948952 TTGTTGAAAGGATAAATGTATGG + Intronic
907219543 1:52896118-52896140 TTGTTCACAGGAAGAAACTAGGG + Exonic
907410625 1:54281000-54281022 TTGTCCAAATGACAAACCTTAGG - Intronic
907556912 1:55352107-55352129 TTTTGCAGATGAAAAACCTAAGG - Intergenic
907778946 1:57546511-57546533 TTTTACAGATGAAAAAACTAAGG - Intronic
907887956 1:58611060-58611082 TTTTGCAAATGAAAAAACTGAGG - Intergenic
908017157 1:59855105-59855127 TTGTTTAAAAGAAAAATAAAAGG - Intronic
908055632 1:60283745-60283767 TTGTTCAATTTAAAGATCTATGG + Intergenic
908065136 1:60394961-60394983 ATTTTCAAATGAACAATCTTTGG + Intergenic
908402218 1:63782166-63782188 TTTTTCAAATGACAGATTTATGG + Intronic
908596752 1:65696526-65696548 TTCTTCCAGTGAAAAATTTAGGG + Intergenic
909106586 1:71417674-71417696 TTGTTCAACTGAGAAAACTGAGG - Intronic
909335495 1:74467785-74467807 TTGTTGAAATGAAGATTCTGGGG + Intronic
910614438 1:89181765-89181787 TTGTTCAAAGGAAAACTATAAGG - Exonic
910869698 1:91821774-91821796 TTTTACAAATGAGAAAACTAAGG - Intronic
911373407 1:97022215-97022237 TTGTTGAAATAAATAGTCTATGG - Intergenic
911651598 1:100395175-100395197 TTTTACAAATGAGAAAACTAAGG - Intronic
911783150 1:101909370-101909392 TTGTACAAATGAAAAGTATTTGG + Intronic
911830439 1:102544193-102544215 TTTTTAATATGAAAAATCTGTGG - Intergenic
912039100 1:105362912-105362934 TTATTCAAATAAAAAATAGACGG + Intergenic
912109180 1:106318997-106319019 TTGTTCTAAAGAAAAATACAGGG + Intergenic
913017656 1:114756001-114756023 TTGTTTAAAACAAAAATCGATGG + Intronic
913390866 1:118310696-118310718 AAGTTAAAATGAAAAATGTAAGG - Intergenic
914668080 1:149849097-149849119 TTGCTCAAGCCAAAAATCTAGGG + Intronic
915261516 1:154679938-154679960 TTCTTAAAATGCAAAATCTCAGG - Intergenic
915388909 1:155523175-155523197 TTGTTGTAATGAAAAGTCTCAGG - Intronic
915847863 1:159287037-159287059 ATGCACAATTGAAAAATCTAGGG + Intergenic
915984623 1:160452195-160452217 TTGTACAAATTAAAAAGCTCAGG + Intergenic
916232964 1:162558523-162558545 TTGATCAAATGAAAAAATTCTGG - Intergenic
916371657 1:164103002-164103024 TTTTACAAATGAGAAATCTGAGG - Intergenic
916475502 1:165164880-165164902 TTTATCAACTGAAAAATCCAGGG - Intergenic
916702014 1:167306549-167306571 TTTTTCAAATGAGAAAATTAAGG + Intronic
916997656 1:170318036-170318058 TTGTTCAAATACAAAATTTTGGG - Intergenic
917715728 1:177735183-177735205 TTGAGCAAATGAAAAATGAATGG + Intergenic
918399967 1:184153481-184153503 TTGATCAAATGAAACATCCTGGG + Intergenic
918621306 1:186609149-186609171 TTATTCATTTGAAAAATCAAGGG - Intergenic
918640474 1:186834903-186834925 TTGTCCAAATGATAAATCCAAGG - Intronic
918893787 1:190313723-190313745 TATTTCAAATGAGAAAACTAAGG + Intronic
919367200 1:196676918-196676940 TTGTTAAAATAAAAATTTTAGGG - Intronic
920130504 1:203728417-203728439 TTTTTGAAATGGAAAATCTCAGG - Intronic
921144890 1:212344860-212344882 TTGCTAAGCTGAAAAATCTATGG + Intronic
921522334 1:216171454-216171476 TTGCTCAAATGTTATATCTAGGG - Intronic
921974944 1:221191965-221191987 TTGTTCATAGGAAGGATCTAAGG + Intergenic
922054991 1:222033458-222033480 TTTTGCAGATGAAAAATCTAAGG + Intergenic
922284723 1:224160068-224160090 TTGTTCAAATCTTAAATCTTAGG + Exonic
923558700 1:235022047-235022069 TTGTTCACTTTAAAAATGTAAGG + Intergenic
923809869 1:237301938-237301960 TTGATCTAAAGAAAAATCTCAGG + Intronic
924028065 1:239858503-239858525 TTTTCCAAATGAAAATACTATGG - Intronic
924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG + Intronic
924144210 1:241057324-241057346 TTGTACAAATGAGAAACCCAAGG - Intronic
924471357 1:244345436-244345458 TTCTTCAAATGAGAAAATTAAGG + Intergenic
924504117 1:244664869-244664891 TTTTTGCAAGGAAAAATCTAGGG - Intronic
924797843 1:247305375-247305397 TTTTCCAAATAAAAAATGTAAGG + Intronic
1062787123 10:273908-273930 TTATTCACAAGAAAAATCAATGG - Intergenic
1063445385 10:6111106-6111128 TTGTTCAAATGAAAATGTTAAGG + Intronic
1065330722 10:24595637-24595659 TTGTTCAATTTAATATTCTATGG + Intronic
1066179030 10:32941908-32941930 TTGTTTTATTGCAAAATCTAGGG + Intronic
1066554105 10:36592533-36592555 TTGTTCAAATTCAAATTCTTAGG + Intergenic
1067222018 10:44351133-44351155 TTTTACAAATGAAGAAACTAAGG + Intergenic
1067783242 10:49224260-49224282 TTGCTCAAAAGAAATATCTGAGG + Intergenic
1068198657 10:53752323-53752345 TTAATCAGATGAAAAAGCTATGG + Intergenic
1068634189 10:59330410-59330432 GTATTCAAATGTAAAATCAATGG + Intronic
1068923010 10:62504844-62504866 TTTTCTAAATGAAAAAACTAAGG + Intronic
1068982307 10:63074499-63074521 TTGTCCAAATGAGAAAACTTTGG - Intergenic
1069195292 10:65544044-65544066 TTTTTCAAATGACAAATAAAGGG - Intergenic
1069434100 10:68365132-68365154 TTATTCCACTGAAAAATATATGG - Intronic
1070452592 10:76576854-76576876 TTTTCCAAATGAGAAAACTAAGG - Intergenic
1070485042 10:76922235-76922257 TTCTTCAAATGAAGAAACTGAGG + Intronic
1070531055 10:77337908-77337930 ATGTTAAAATGAAGAATCTTGGG + Intronic
1070597075 10:77840071-77840093 TTGTGCAAATGAAGAAACTAAGG + Intronic
1071240457 10:83699312-83699334 ATGTTAAAATCAAAAAGCTATGG + Intergenic
1071356845 10:84805562-84805584 TTTTACAAATGAAAAACCTGAGG + Intergenic
1071685447 10:87750080-87750102 TTGTGCAAATGAAATCTCTTAGG - Intergenic
1072244488 10:93530470-93530492 TTTTTCAGATGAGAAAACTAAGG + Intergenic
1072317857 10:94221207-94221229 TTGTTCAAATGTAGATTCCAAGG - Intronic
1072524827 10:96262446-96262468 TTTTTCAGATGAAAAACCTGAGG + Intronic
1072754019 10:98005989-98006011 TTTATCAAATGAATAATCTTTGG + Intronic
1072807369 10:98432564-98432586 TTGTTAAAATGAAAAACTCAAGG - Intronic
1072820209 10:98549217-98549239 TTTTACAGATGAAAAATCTAAGG - Intronic
1073227879 10:101939198-101939220 TTGAGAAAATGAAAAATCAAAGG + Intronic
1073270094 10:102255339-102255361 TTGTAAAAAAGAAACATCTAGGG - Intronic
1073521087 10:104130130-104130152 TTGTTCAAATGTAAAAACGCTGG - Exonic
1073575683 10:104620916-104620938 TTTTTCTAATGAGAAAACTAAGG - Intergenic
1074011367 10:109484587-109484609 TTATTCAGATGAAAAATATAGGG - Intergenic
1074461322 10:113640020-113640042 TAGTTCACATTGAAAATCTAAGG + Intronic
1075578655 10:123599354-123599376 TTTTTCATATGGAAAAACTAAGG + Intergenic
1076283379 10:129270457-129270479 TTGTTGAAATGAAATATCAATGG + Intergenic
1076349433 10:129805715-129805737 TTTTTCAAAGGAAGAATCTGTGG + Intergenic
1076868644 10:133181964-133181986 TTGTTCAAATAAGACATCTCAGG + Intronic
1077786033 11:5384344-5384366 TTTTCCAAGTGAAAAATCTAAGG - Intronic
1078749237 11:14144050-14144072 TTTTTCAAATGTAAAATCTAAGG - Intronic
1078854332 11:15194435-15194457 TTGTTAAAATGAAGATTCTCAGG - Intronic
1079215058 11:18502029-18502051 TTCTTCAACTAAAAAAACTAAGG - Intronic
1079417465 11:20252953-20252975 TTTTACAGATGAGAAATCTAAGG - Intergenic
1079666202 11:23109103-23109125 TTGTTCAAATTAAAAATAAAAGG + Intergenic
1079686105 11:23362014-23362036 TTTTACAGAAGAAAAATCTAAGG - Intergenic
1079954568 11:26846868-26846890 TTCTTCCAATGCAAAATCCATGG - Intergenic
1080017674 11:27524555-27524577 TGGTTCAGATTAAAAATCCAGGG - Intergenic
1080116330 11:28625057-28625079 TTGTTTAAACAAAAAATCCAGGG - Intergenic
1080197934 11:29633290-29633312 TTTTACAAATGAAAACCCTAAGG + Intergenic
1080782021 11:35438456-35438478 CTTTTCAAAAGAAAAAACTAAGG + Intronic
1080857194 11:36122396-36122418 TTTTTCAGATGGAAAATCTGAGG - Intronic
1081236809 11:40656330-40656352 GTGTTTATATGAAAAATATATGG + Intronic
1082058909 11:47844038-47844060 TTGCTCAAGCCAAAAATCTAGGG + Intronic
1082163229 11:48907537-48907559 CTGTTCAAATGAATACACTAAGG - Intergenic
1082169580 11:48987099-48987121 CTGTTCAAATGAATACACTAAGG + Intergenic
1082234631 11:49808970-49808992 CTGTTCAAATGAATACACTAAGG - Intergenic
1082611465 11:55303704-55303726 CTGTTCAAATGAATACACTAAGG + Intergenic
1082658452 11:55879986-55880008 CTGTTCAAATGAATACACTAAGG - Intergenic
1082921207 11:58496326-58496348 TTTTTCAGATGAGAAAACTAAGG - Intergenic
1083458967 11:62798510-62798532 TTGTTAGAATGAAAAAATTATGG + Intronic
1084449178 11:69223108-69223130 TTGTTGGAATGACAAATTTATGG - Intergenic
1086290337 11:85301592-85301614 CTGTAGAAATGAAAAAACTAAGG + Intronic
1086459376 11:86990726-86990748 TTGTTAAAATGCAAATTCTCAGG - Intergenic
1086696253 11:89849542-89849564 CTGTTCAAATGAATACACTAAGG - Intergenic
1086709903 11:89994947-89994969 CTGTTCAAATGAATACACTAAGG + Intergenic
1086836339 11:91628256-91628278 TTATTCTATTGAGAAATCTATGG - Intergenic
1086841830 11:91695284-91695306 TTTTTCAAATGAAGAAACTGAGG + Intergenic
1087592453 11:100208447-100208469 TTGTTCACATTAAAGATCTCAGG + Intronic
1087660520 11:100982317-100982339 TTGTTAAAATGAAGATTCCAGGG + Intronic
1087706105 11:101493635-101493657 TTTTGCACATGAAAAAACTAAGG + Intronic
1088080489 11:105906237-105906259 TTTTTCAAATGAGAAAATTATGG + Intronic
1088591317 11:111405814-111405836 TTTTACAAGTGAAAAAACTAAGG - Intronic
1088979868 11:114852442-114852464 TTGTACAAATGAGGAAACTAAGG - Intergenic
1090629113 11:128630978-128631000 TTGTACAAATAAGAAAACTAGGG + Intergenic
1090918487 11:131187608-131187630 TTTTTCCAATAAAAAAACTAAGG - Intergenic
1091008322 11:131974700-131974722 TTTTTCAAGTGAAAAGACTAAGG - Intronic
1092438663 12:8476261-8476283 TTGTTTACATAGAAAATCTAGGG + Intronic
1092534313 12:9373587-9373609 TTATTAAAATAAAAAATATATGG - Intergenic
1093285755 12:17259149-17259171 TTTTTTAAATGTAAAATGTATGG - Intergenic
1093548735 12:20380786-20380808 TTTTTCAAATGAAAACCATATGG - Intronic
1094105023 12:26801685-26801707 TTGTCCAGAGGAAAAAACTAGGG - Intronic
1094109931 12:26851689-26851711 ATGTGGAAATGAAAAAACTAAGG + Intergenic
1094601555 12:31913203-31913225 TTTTTTAAATGAAGATTCTAAGG + Intergenic
1095088199 12:38081397-38081419 ATATTGAAATAAAAAATCTAAGG + Intergenic
1095212364 12:39509378-39509400 TGCTTCAAATGGAGAATCTAAGG + Intergenic
1095606623 12:44075536-44075558 TTTTACAAGTAAAAAATCTAAGG - Intronic
1096129347 12:49145354-49145376 TTGCTCAGACCAAAAATCTAGGG - Intergenic
1096505757 12:52091669-52091691 ATGATCAAAGGAAAAATTTAAGG - Intergenic
1096925632 12:55141816-55141838 TTGGTCAAATGATACTTCTAAGG - Intergenic
1097163933 12:57071854-57071876 TTGTTCACATCAAAAACATAAGG - Intronic
1097513892 12:60578342-60578364 ATGTTCAGAATAAAAATCTATGG - Intergenic
1097646308 12:62238527-62238549 TTTTACAAATGACAAATCTGAGG + Intronic
1097789066 12:63794779-63794801 TTTTTTAAATGAAAAATCATGGG - Intronic
1098307092 12:69113174-69113196 TTTTTCAGATGAATAATCTGAGG - Intergenic
1098575747 12:72040148-72040170 TTGTCTACATGAAAAATCTGTGG + Intronic
1098724300 12:73943251-73943273 TTGGTGACATGAAAAATCTTAGG - Intergenic
1098864042 12:75741830-75741852 TTGTTTAAATGAAAAGGCAAGGG - Intergenic
1099099422 12:78419613-78419635 TTTTACAAATGTAAATTCTATGG - Intergenic
1099123408 12:78721191-78721213 TTTTTCAAATGAAGAAACTGAGG + Intergenic
1099777731 12:87154752-87154774 GGGTTCAAATGAGAAACCTAAGG + Intergenic
1100197322 12:92261886-92261908 TTTTTCAGATGAAAAAACTGAGG + Intergenic
1101512068 12:105402324-105402346 TTATACAAATGAAAAAGCTGAGG - Intergenic
1102066520 12:109980737-109980759 TATTAAAAATGAAAAATCTAAGG + Intronic
1102322297 12:111947054-111947076 TTGATTAAATGTAAAATCTTTGG - Intronic
1103618688 12:122172292-122172314 TTTTTCCAATGAATAATCTCAGG - Exonic
1104317177 12:127714032-127714054 TTTTACAAATGAGAAATCTGAGG + Intergenic
1105445106 13:20447177-20447199 ATGTCCACAGGAAAAATCTAAGG + Intronic
1105727208 13:23175970-23175992 TTGTTTATGTGAAAGATCTATGG + Intergenic
1106147711 13:27065130-27065152 TTTTACAAAGGAAGAATCTAAGG - Intergenic
1106174834 13:27321376-27321398 TTTTTTAAATGGAAAATTTATGG - Intergenic
1106854451 13:33834054-33834076 TATTTCAGATGAAAAAACTAAGG - Intronic
1107141509 13:37003346-37003368 TTGTTGAAAAGAAAAATTTGAGG + Intronic
1107176166 13:37401356-37401378 TTGTCTACATTAAAAATCTATGG - Intergenic
1107334110 13:39334945-39334967 TTTTACAAATGAACAAACTAAGG + Intergenic
1107382016 13:39866994-39867016 ATGTTTAAATGAAACATCAAAGG - Intergenic
1109000337 13:56793967-56793989 TTGTTGAAATGATAAAATTATGG - Intergenic
1109119135 13:58431560-58431582 TTTTATAAATGAAAAATCAAGGG - Intergenic
1109324338 13:60849572-60849594 TTTTGCAAATGAAAAATTTGAGG + Intergenic
1109648952 13:65299242-65299264 ATTTTCAGATGAAAAAACTAAGG - Intergenic
1109691398 13:65895524-65895546 TTGTTTAAATTATAAATCCACGG - Intergenic
1109705700 13:66089162-66089184 TTGTTCAAATAAAATTTCTAGGG + Intergenic
1109812553 13:67533365-67533387 TGGTTCAAATGAAAAGTCTCAGG + Intergenic
1109858706 13:68170041-68170063 TTGTTGAAATGATAAAACTGTGG - Intergenic
1110102471 13:71626765-71626787 TAATTCAAATCATAAATCTATGG + Intronic
1110523800 13:76512282-76512304 TTCTGCAAATGAGAAAACTAAGG - Intergenic
1110801328 13:79699880-79699902 TTGTAAAATTGAAAAATCTGTGG + Intergenic
1110958596 13:81590816-81590838 TTGTAAAGATGAAAAATATATGG + Intergenic
1111238099 13:85435290-85435312 TTCTTCAATAGAAAAATCAATGG + Intergenic
1111284629 13:86072764-86072786 TTCCTCAAATGAAATATGTAGGG - Intergenic
1111486984 13:88916186-88916208 TTATTCAAATAAAAAAAGTATGG + Intergenic
1112030505 13:95452253-95452275 ATATTCACATGAAAAATCTCAGG + Intronic
1112040437 13:95541835-95541857 TTTTACATATGAAAAATATAAGG - Intronic
1112209831 13:97364759-97364781 TTTTACAGATGAAAAATCTGAGG - Intronic
1112716427 13:102191322-102191344 TTGTTCAAATGATCAGTCTCTGG - Intronic
1112723046 13:102267866-102267888 TTATTCAAATGTATTATCTAAGG + Intronic
1112818846 13:103307207-103307229 TTTTTTAAATGAAAAACCTCAGG - Intergenic
1113351547 13:109534172-109534194 TTGTTATGATTAAAAATCTATGG - Intergenic
1114377430 14:22163232-22163254 TTGTTCATATGTAAAATGAAGGG + Intergenic
1114738387 14:25067300-25067322 ATGCTGAAATGAACAATCTATGG + Intergenic
1114747189 14:25162117-25162139 TTGTTGAAATGAAAAATAAGGGG - Intergenic
1115358577 14:32476152-32476174 TTGTTGAATTGATAAATATAAGG - Intronic
1115365171 14:32549719-32549741 TTTTTCAGATGAAGAAACTAAGG + Intronic
1115478024 14:33834966-33834988 TTTTTCAAATGAAAACTCAATGG - Intergenic
1115801396 14:36997939-36997961 TTTTACAAATGAGACATCTAAGG + Intronic
1116514162 14:45785983-45786005 TTGTTTAATTTAAAAATCTGAGG - Intergenic
1116554206 14:46282668-46282690 TAGTTTAAATGAAAAAACTTAGG + Intergenic
1116589487 14:46752846-46752868 TTGTTCAATTCAAACATCCAAGG + Intergenic
1116592135 14:46791258-46791280 TTTTTTTAATGAAAAATCTCTGG - Intergenic
1117477188 14:56107804-56107826 TAGTTCACGTGAAAAATCCAAGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118205419 14:63718372-63718394 TTTTTCAAATAAAAGAGCTAAGG + Intronic
1118391462 14:65299303-65299325 TTTTTAAAAAGAAAAATCTCTGG + Intergenic
1118690127 14:68330391-68330413 TTGTAAAAATGAAATGTCTAAGG - Intronic
1119940206 14:78632608-78632630 TTTTTCAAATGATAAAACTAAGG - Intronic
1120093715 14:80364061-80364083 TTTTACAAATGAGAAAACTAGGG + Intronic
1120310441 14:82820247-82820269 TTTTACAAATGAAGAAACTAAGG - Intergenic
1120942704 14:89964044-89964066 TTGTTAAAATGCAAATTCTCGGG + Intronic
1121868715 14:97387358-97387380 TTTTTCACCTGAAAAATCTGGGG + Intergenic
1122103476 14:99432564-99432586 TTGTTCTAAACAAAAGTCTAAGG + Intronic
1122724411 14:103740838-103740860 TTTTTCAAAAGAAAAAAATAGGG + Intronic
1123669005 15:22635507-22635529 TTCTTCAAAAGAAAAAGCCAAGG - Intergenic
1123824266 15:24065550-24065572 TTGTTTAAATGAATGACCTATGG - Intergenic
1124720007 15:32103777-32103799 TTATCCAAATGAAAAGTCTGTGG - Intronic
1124985229 15:34602995-34603017 TTTTCCAAATGAATCATCTAAGG + Intergenic
1125125377 15:36214002-36214024 TTGTTCATATGGCAAATTTAAGG + Intergenic
1125217985 15:37299808-37299830 TTGTTCAAATTTATAATCAAAGG + Intergenic
1125345008 15:38710433-38710455 GTGCTCAAATGAAAGTTCTATGG + Intergenic
1125448678 15:39785065-39785087 TTTTTCAAATGAAGAAACTGTGG - Intergenic
1125552422 15:40555879-40555901 TTATTCAAAGTAAAAATCAATGG - Intronic
1125898451 15:43323064-43323086 CTGTTCAAATGTAAATTCAATGG + Intergenic
1126268088 15:46778642-46778664 TTGTTGAAATGCAGAATCTGAGG - Intergenic
1126531666 15:49717406-49717428 TTTTTCAAATGAAAAAAGGAAGG - Intergenic
1126587608 15:50304943-50304965 TTTTTCAAAGGAAAAATCTTAGG + Intronic
1126981737 15:54251520-54251542 TTTTGGAAATGAAAAATTTAAGG - Intronic
1127592777 15:60443564-60443586 TTGTTAAAATGTAGAATCTGGGG + Intronic
1128158232 15:65405498-65405520 TTTTTCAAATGAGAAAACTGTGG - Intronic
1128169500 15:65498511-65498533 AACTTCAAATGAAAAAGCTAAGG + Intronic
1128304074 15:66586692-66586714 TTGTTCAGATGAAGAAACTGAGG - Intronic
1128381088 15:67113416-67113438 TTGTTCAAAAAAAGAATCTGTGG + Intronic
1128506125 15:68274026-68274048 TTCTTCAGATGAAGAAACTAAGG - Intergenic
1129434742 15:75529603-75529625 TTTTTCAATTGAAAAATAAAGGG + Intronic
1129444151 15:75604661-75604683 TTTTTCAGATGGAAAATCTAAGG + Intronic
1131707068 15:95008486-95008508 TTGTTTTAATGAAAAATTGAGGG + Intergenic
1133492313 16:6282237-6282259 ATCTTAAAGTGAAAAATCTAAGG + Intronic
1133606784 16:7395221-7395243 TTGTTCAAATTACAAAGCTTAGG + Intronic
1133643427 16:7740038-7740060 TTTTTCACATGACAAATCTGAGG - Intergenic
1134106520 16:11489313-11489335 TTCTTCAGATGAGAAAACTAAGG - Intronic
1134201141 16:12200113-12200135 TTGTACAGATGAAAAAACTGAGG - Intronic
1135843016 16:25893728-25893750 TTTTTCAAATGAAAATTGTGGGG + Intronic
1136224336 16:28848453-28848475 TTTTTCAAATGAAAACTCAGAGG + Intronic
1136533610 16:30886323-30886345 TTGCTCAGATGAACAAACTAAGG + Intronic
1137438667 16:48479900-48479922 CTGTTCCAATGTAAAATCCAGGG + Intergenic
1137511931 16:49108363-49108385 TTGTGCAAATGAGAAAACTCAGG - Intergenic
1137629396 16:49931595-49931617 TTGTTCAAATGGGAAAACTGAGG + Intergenic
1138115842 16:54359779-54359801 TTGTTCAGATGAAGAAACTAAGG + Intergenic
1138217863 16:55220920-55220942 TAAATCAAATGAAAATTCTAGGG + Intergenic
1138382958 16:56616573-56616595 TTTTTCCAATGGAAAAACTAAGG - Intergenic
1138794264 16:59948761-59948783 TAGTTCAAATTAAAAATGTATGG + Intergenic
1138821718 16:60268294-60268316 TTGTTTAAAAGGAAAATCTGAGG + Intergenic
1139263630 16:65619700-65619722 TTGCTCAAATGAATATTCTTTGG - Intergenic
1139357945 16:66378582-66378604 TTGTTCAAATGAGGAAACTGAGG - Intronic
1140024884 16:71277929-71277951 TTTTTCAAATGACAAATTCATGG + Intergenic
1140343110 16:74184951-74184973 TTGCTGAAATGCAAAATATAAGG + Intergenic
1140355543 16:74302770-74302792 TTTTACAAATGAAAAGTTTAAGG + Intronic
1140725488 16:77807799-77807821 TTGTTGAGATGGAAAAACTAAGG + Intronic
1140815854 16:78620180-78620202 TTTCTGAAATGAGAAATCTAAGG + Intronic
1141029712 16:80577089-80577111 TTTTTCAAAAGAGAAATCTGAGG - Intergenic
1141069141 16:80937495-80937517 TTCTTCAAATCTAAACTCTAAGG + Intergenic
1142606234 17:1082717-1082739 TTGTTCAAATATAGAATCTTGGG + Intronic
1144059184 17:11567249-11567271 TTGTTAAAATGCAAATTCCAGGG - Intergenic
1144196858 17:12902772-12902794 TTTTCCAAATGAAGAAGCTAAGG - Intronic
1145374598 17:22335853-22335875 TTCATCAAATGTAAAAACTATGG - Intergenic
1146568470 17:33933474-33933496 TTTTTCAAATGAATAAGCTCAGG + Intronic
1146786206 17:35724115-35724137 TTGTACATATGAGAAATCAAGGG + Intronic
1147034091 17:37667018-37667040 CAGTTCAAATAAAAAATATATGG - Intergenic
1147111254 17:38263510-38263532 ATCTGCAAATGAAAAACCTATGG + Intergenic
1147436009 17:40415862-40415884 ATGCTAAAATGAAAAACCTATGG - Intronic
1147438422 17:40431950-40431972 TTGTACAAATGGGAAAACTAAGG + Intergenic
1148374407 17:47129392-47129414 ATTTGCAAATGAAAAATATAAGG - Exonic
1148418258 17:47524940-47524962 ATCTGCAAATGAAAAACCTATGG - Intronic
1149627939 17:58093137-58093159 TTGCTCAAATGAAAAAAGAAGGG + Exonic
1150024762 17:61662290-61662312 TTGTTCAACTGAAGAATATACGG - Intergenic
1150033348 17:61765277-61765299 ATTTTTAAGTGAAAAATCTAGGG - Intronic
1150222177 17:63501862-63501884 ATGCTAAAATGAAAAATATAGGG - Intronic
1150843206 17:68628669-68628691 TTTTACAATTGAAGAATCTAAGG - Intergenic
1151142309 17:72005593-72005615 TTGTTAAGATGATAAATTTATGG + Intergenic
1151637840 17:75364439-75364461 TTTTACAGATGAAGAATCTAAGG + Intronic
1152304051 17:79510990-79511012 TTGTCCAAATAGAAAATCTGAGG + Intronic
1203171858 17_GL000205v2_random:155695-155717 TTGCTGAAAGGAAAAATGTATGG + Intergenic
1203173878 17_GL000205v2_random:177062-177084 TTGCTTAAAGGAAAAATGTATGG - Intergenic
1153600193 18:6773510-6773532 TTATTCAGATGGAAAATCTGAGG + Intronic
1153757048 18:8294686-8294708 TTTTTGAAATGATAAATATAAGG + Intronic
1155031418 18:21988158-21988180 TTCTTGAAATGAAAAAATTACGG + Intergenic
1155083703 18:22434735-22434757 TTGTTTAAATTAAAAATAGAGGG + Intergenic
1155243692 18:23887083-23887105 TTCTTTCAATGAAAAATGTATGG + Intronic
1155264839 18:24081741-24081763 TTTTTTAAATGAAAAATTAATGG - Intronic
1155419646 18:25641252-25641274 TTGTTGAAATAAAAAATTCATGG - Intergenic
1155645776 18:28075806-28075828 TTGTTCAATTTAAAGATCTGTGG - Intronic
1155813715 18:30275270-30275292 TTTTACAGATGAAAAATCTGAGG + Intergenic
1155852937 18:30795069-30795091 TTGTTCAAGCTCAAAATCTAAGG + Intergenic
1156202104 18:34845229-34845251 TTGTGCACATGAACAATTTATGG - Intronic
1156530997 18:37814816-37814838 TTGTTCAAGTCAGAAATCTTAGG - Intergenic
1156584451 18:38416189-38416211 TTTTACAAATGAAGAAACTAAGG - Intergenic
1156658304 18:39313910-39313932 TTGTTAAAGTGAAAATTCTCAGG - Intergenic
1156697822 18:39788823-39788845 TTGGTCAAATTAAAAACCAATGG + Intergenic
1156929396 18:42623114-42623136 TTTTTCAATTAAAAAATTTAAGG - Intergenic
1157175908 18:45452026-45452048 TTTTTCAAATCAAAAATATGGGG + Intronic
1157902397 18:51532104-51532126 TTTTTCAGATGAAAAAACTGAGG + Intergenic
1158287610 18:55901915-55901937 TTTTTCAACTGAAAAATATCAGG - Intergenic
1158842752 18:61405724-61405746 TTGTTAAAATGCAAATTCTTGGG + Intronic
1158917873 18:62154063-62154085 TTGATCATAATAAAAATCTATGG - Intronic
1159009473 18:63044921-63044943 TTTTTGAAATGAGAAAACTAAGG + Intergenic
1159062791 18:63533415-63533437 TTGTTCACATGAGAATTGTATGG - Intergenic
1159169433 18:64745843-64745865 TGGTTTAAATGGAAATTCTAAGG + Intergenic
1159265784 18:66076589-66076611 TTTTGCAAATGAAGAAACTAAGG - Intergenic
1159735335 18:72090052-72090074 TTGTTAAAATGAATTATCTGAGG - Intergenic
1160089591 18:75813995-75814017 TTGCTCGAATCAAAAATATAGGG - Intergenic
1160195121 18:76747523-76747545 TTGATAAAATGTAAAATCTTTGG + Intergenic
1162962133 19:14134634-14134656 CTGTACAAATCCAAAATCTAAGG - Intronic
1163244631 19:16085683-16085705 TTTTACAAATGAAGAAACTAAGG - Intronic
1164141363 19:22468169-22468191 TTCTCAAAATGAAAAATTTACGG - Intronic
1164732111 19:30514205-30514227 TGCTTCAATTGAATAATCTATGG - Intronic
1166028901 19:40110572-40110594 TTGATAAAATGTAAAATCTTTGG + Intergenic
1166842606 19:45707530-45707552 TTTTACAAATGAAAAATGCAAGG - Intergenic
1167228742 19:48268003-48268025 GTGTTCAAAAGTAAAATGTATGG - Intronic
1167967649 19:53160397-53160419 TTGTTAAAGTGAAAACTATACGG - Intronic
1168517347 19:57018616-57018638 TTTTACAGATGAGAAATCTACGG + Intergenic
925514792 2:4668740-4668762 TTGTTCAAAGAAAAATTTTAAGG - Intergenic
926177075 2:10603434-10603456 TTGTGGAAATAAAAAATCTGAGG - Intronic
926264187 2:11299416-11299438 AAGTTCACATGAAAAATCAAAGG + Intronic
926792870 2:16593001-16593023 TTGTGCAAATGAAGAACCCAAGG - Intronic
927627552 2:24738065-24738087 ATGTTAAAATGACAAATCTAAGG - Intronic
927823458 2:26289527-26289549 CTGTTAAAATGAGAAATCCAGGG - Intronic
928229528 2:29485267-29485289 TTGTTCAAATGGAAAATTAGAGG - Intronic
928235103 2:29532397-29532419 TTTTGCAGATGAAAAATCGAAGG - Intronic
929071877 2:38039220-38039242 TTTTACAAATGAGAAAACTATGG + Intronic
929193306 2:39160141-39160163 TTTTACAAATGAGAAATCTCAGG - Intergenic
929953127 2:46432328-46432350 TTGTTAAAAAAAAAAAACTATGG + Intronic
930310910 2:49738313-49738335 TTTTTCAAATGAGAAAACAAAGG + Intergenic
930346016 2:50181976-50181998 TTTTTCAACTTAAAAAACTAAGG + Intronic
930759580 2:55019236-55019258 AGGGTCAAATGAAAAATGTACGG + Intronic
930804469 2:55476527-55476549 TTGTTCAAGTCAGAAATTTAAGG + Intergenic
932074865 2:68653454-68653476 TTCTTCAAATCAAAATTCCAAGG + Intronic
932516705 2:72358561-72358583 TTTTACAAATGAAAAAAATAAGG + Intronic
932747212 2:74343954-74343976 TTGTTTAAGTGAAAAAGATACGG + Intronic
932830043 2:74980584-74980606 TTGTACAAATGAGAAAACTGAGG + Intergenic
933164735 2:79063753-79063775 TTGTTAGAATGCAAAATCTTAGG + Intergenic
933196704 2:79398475-79398497 TTGTTTAAATGGAAACTCTTGGG - Intronic
933392634 2:81691343-81691365 CTGCTCAAAGGAAATATCTAGGG - Intergenic
933501077 2:83112276-83112298 TTATTCAAATGAGAATTCTCTGG - Intergenic
933889353 2:86752628-86752650 TTCTACAGATGAAAAATCTAAGG + Intronic
934092251 2:88561998-88562020 TTGTTATAAGTAAAAATCTAGGG - Intronic
934630835 2:95919586-95919608 TATTACAAATGAAAAATCTCAGG + Intronic
934784586 2:96995894-96995916 TTTTTCAAATGAAGAAACTGAGG + Intronic
935086380 2:99849510-99849532 TTCTACAAATGAAAAACGTATGG - Intronic
935811042 2:106797411-106797433 TTTGTCAAATGCAAAATCAATGG + Intergenic
936680261 2:114761874-114761896 TAGGTAAAATGAAAAATCAATGG - Intronic
936719774 2:115237141-115237163 TTTTCCAAATGAAAAATTTTTGG + Intronic
937494084 2:122399806-122399828 TTTTTCAAATAAAAAAACTGAGG - Intergenic
937768557 2:125691457-125691479 ATATTCAAATGAAAAATACAAGG + Intergenic
938047537 2:128135959-128135981 TTGATCAAAAGAGAAATATAAGG + Intronic
938598424 2:132812368-132812390 TTTTTCAAATGAGAAAACTGAGG + Intronic
938855946 2:135310681-135310703 TTTTTCATATGAAAAACCAAAGG + Intronic
939793611 2:146613323-146613345 TTGTTCAAATGACAAATATGTGG - Intergenic
940182532 2:150951802-150951824 TTTTTAAATTGAAAAATATATGG - Intergenic
940895286 2:159075751-159075773 TTTTTTAAATGAAAAAAATATGG - Intronic
941493002 2:166165484-166165506 CTGTTCAAAAGAAAAATTTAAGG - Intergenic
942131755 2:172886881-172886903 TTTTTCAAATTAAATAGCTAGGG - Intronic
942437621 2:175998090-175998112 TTTTACAAATGAGAAATCTAAGG + Intronic
942472541 2:176276042-176276064 TTTTACAAATGAGAAATCTCAGG - Intronic
942516619 2:176760786-176760808 TTCTTTAAATAAAAAATCTCAGG + Intergenic
942666634 2:178326287-178326309 TTTTCCAAATGAAAAAACTTGGG + Intronic
942730911 2:179059855-179059877 TTGTCCAAATTAAAAATTCAAGG + Intergenic
943225938 2:185176031-185176053 TTTTTCAAATGAAATATAAATGG - Intergenic
943611273 2:190037890-190037912 TTTTTACAATGAAAAATTTAGGG + Intronic
943700891 2:190987291-190987313 TTGTGCAAATGAACAATGTAAGG - Intronic
943814947 2:192241465-192241487 TAGTCCAAATGCAAAATCAATGG - Intergenic
944243180 2:197505400-197505422 TTGGTTAAAAAAAAAATCTAAGG + Intronic
944335411 2:198527885-198527907 TTTTACAAATGAGAAAACTAAGG - Intronic
944523149 2:200591648-200591670 TTGTTAAAATGAAACCGCTATGG - Intronic
944532256 2:200679044-200679066 TTGTTAAAATTAAAAATCTCAGG - Intergenic
944749296 2:202691486-202691508 TTTTTTTAATTAAAAATCTAAGG - Intronic
945111147 2:206360901-206360923 TTGTTCTAATGAACAACCTGAGG - Intergenic
945222887 2:207502730-207502752 TTTTTCAGATGAAGAAACTAAGG + Intergenic
945418282 2:209602140-209602162 TTGTTCGAACTAAAAAACTAAGG - Intronic
945435495 2:209812437-209812459 TTTTTTAATTAAAAAATCTACGG - Intronic
945672449 2:212818654-212818676 TCGGTCAAATGAAAAATGTGAGG + Intergenic
945707380 2:213252525-213252547 TTGTTCCAATCAAAAAAATAGGG + Intergenic
945811851 2:214558486-214558508 TTGTTCAAATTAGAAACTTAAGG + Intronic
945968514 2:216213517-216213539 TTGATAAAATGTAAAATCTTTGG + Intergenic
946323469 2:218968459-218968481 TTATTCAAATAATAAAGCTAGGG + Intergenic
946417072 2:219545149-219545171 TTGTTCAGATGAGAAAACTGAGG - Intronic
947033232 2:225821895-225821917 TTGTGCAAATGGAAAAACAAAGG - Intergenic
947234209 2:227922825-227922847 GTGTTCACAACAAAAATCTATGG - Intronic
947255066 2:228154356-228154378 TTCTTCAAATATAAAAACTAAGG - Intronic
947674459 2:231964803-231964825 TTGTTTAAATGCAAAATATGTGG + Intronic
948262010 2:236611350-236611372 TTGTTTTAATGAAACATTTATGG - Intergenic
1168890233 20:1290930-1290952 TTTTTCAGGTTAAAAATCTATGG - Intronic
1169964739 20:11203818-11203840 TAGTTCAAATGATAAAAATAGGG + Intergenic
1170137841 20:13094718-13094740 TTGTTCAAATGAAAAATCTATGG + Intronic
1170683272 20:18545751-18545773 TTGTTAAAATGCAGACTCTAGGG - Intronic
1170993332 20:21326004-21326026 TTGTTCAAGTGAGAAATCATGGG - Intronic
1171528206 20:25832560-25832582 TTCGTCAAATGTAAAAACTATGG + Intronic
1171548620 20:26023318-26023340 TTCGTCAAATGTAAAAACTATGG - Intergenic
1172969597 20:38863615-38863637 CTGTTCAGATGAAAAACCTGGGG - Intronic
1173106950 20:40145744-40145766 TTATTCAACTGAAAAATGAAAGG - Intergenic
1173485415 20:43437502-43437524 CTGCTCAAGTCAAAAATCTAGGG - Intergenic
1174107671 20:48174447-48174469 TTGTTCAAAAGGAAAATCATCGG - Intergenic
1174582815 20:51584529-51584551 TTTTACAGATGAAAAATCTCAGG + Intergenic
1174757766 20:53176472-53176494 TTGTTAGAATGAAAAACCAAGGG + Intronic
1174939899 20:54914589-54914611 TTGGTCAGCTGAGAAATCTAAGG - Intergenic
1174947741 20:55007063-55007085 TTTTTAAAATGCAAATTCTAGGG - Intergenic
1176327838 21:5517532-5517554 TTGCTGAAAGGAAAAATGTATGG + Intergenic
1176329869 21:5538708-5538730 TTGCTTAAAGGAAAAATGTATGG - Intergenic
1176397888 21:6282243-6282265 TTGCTTAAAGGAAAAATGTATGG + Intergenic
1176399919 21:6303419-6303441 TTGCTGAAAGGAAAAATGTATGG - Intergenic
1176437238 21:6685685-6685707 TTGCTGAAAGGAAAAATGTATGG + Intergenic
1176439269 21:6706861-6706883 TTGCTTAAAGGAAAAATGTATGG - Intergenic
1176461500 21:7012755-7012777 TTGCTGAAAGGAAAAATGTATGG + Intergenic
1176463531 21:7033930-7033952 TTGCTTAAAGGAAAAATGTATGG - Intergenic
1176485061 21:7394533-7394555 TTGCTGAAAGGAAAAATGTATGG + Intergenic
1176487092 21:7415709-7415731 TTGCTTAAAGGAAAAATGTATGG - Intergenic
1177158829 21:17526015-17526037 GTATTCAAATGAAAAATATTGGG + Intronic
1177339115 21:19776311-19776333 TTGTTCTAATTAAAATTCTTAGG - Intergenic
1177545300 21:22549167-22549189 CTGTTAAGATGGAAAATCTAAGG - Intergenic
1177936652 21:27355926-27355948 TTATTGAAATGAAAAAACTATGG - Intergenic
1177943472 21:27439851-27439873 TTGTACAAATGACAAAATTAAGG - Intergenic
1178543108 21:33471732-33471754 AGATTCAAATGAAAATTCTAGGG + Intronic
1179242639 21:39605479-39605501 TTTTTCAAATGAAACGTGTATGG - Intronic
1180669770 22:17543921-17543943 TTTTACAGATGAAAAATCCAAGG + Intronic
1180725315 22:17942519-17942541 ATGATCATATGTAAAATCTAAGG + Intronic
1181869771 22:25888560-25888582 TTGTTAAAATGCAAATTCTAGGG - Intronic
1182027163 22:27129174-27129196 TTTTTCAGATGAGAAAACTAAGG - Intergenic
1182173520 22:28257955-28257977 TTATACTAATGAAAAAACTATGG + Intronic
1183206415 22:36422542-36422564 TTGTGCAAAAAAAAAATCTTAGG + Intergenic
1183215575 22:36477512-36477534 TTTTTCAGATGAAGAAACTAGGG - Intronic
1183223802 22:36535238-36535260 TTGTTAAAATGAAAACTCAAGGG - Intergenic
1184014356 22:41774688-41774710 TTTTTCAAATGAGAAAACTGGGG - Intronic
1185141544 22:49105245-49105267 TTACTCAATTGAAAAATCTGAGG + Intergenic
949105901 3:198625-198647 GTGTTAAATTTAAAAATCTATGG - Intronic
949590122 3:5485518-5485540 TTGTTGCAATGAACAATGTATGG + Intergenic
949729475 3:7091945-7091967 TTTTTCAAATGAGAAAATTAAGG - Intronic
950114781 3:10443696-10443718 TTGTGCAACTGAAAACTCCAGGG - Intronic
950464242 3:13143867-13143889 TTATGCAACTAAAAAATCTAAGG - Intergenic
950505574 3:13392458-13392480 TTGAGCAAATGAAAACTCTATGG + Intronic
950603956 3:14061286-14061308 TTGTTTAAAAGAAAAATGTTTGG + Intronic
951438731 3:22696910-22696932 TTGTTAAAGAGAAAAATTTAGGG - Intergenic
951940602 3:28074797-28074819 TTGTCCAATTGAAGAATATATGG + Intergenic
952055741 3:29443171-29443193 TGGTCCAAATAAAAAATCTTGGG + Intronic
952100305 3:30003630-30003652 TTGTTTACATTAAAAATCAAGGG - Intronic
952246650 3:31601159-31601181 TTGGTCATATGACGAATCTATGG - Intronic
952324393 3:32307799-32307821 TTGTTAGAATGCAAATTCTATGG - Intronic
952386862 3:32848177-32848199 TTTAACAAATTAAAAATCTAAGG - Intronic
952520680 3:34153670-34153692 TTTTTTATATGAAAAGTCTAGGG + Intergenic
953900362 3:46837417-46837439 TTGTGGAAATGAAAGATATAAGG - Intergenic
953962408 3:47276727-47276749 TTCTTCAAAGGAAAAATTCAAGG - Intronic
955263308 3:57416742-57416764 TTGTCCAAAAGCAAACTCTAAGG + Intronic
955474741 3:59325305-59325327 TTTTACAAATGGAAAAACTAAGG - Intergenic
955641801 3:61093680-61093702 TTGTTCAAATGAGAATCCTCAGG - Intronic
955979954 3:64514742-64514764 TTTTACACATGAAAAAACTAAGG + Intergenic
956251938 3:67243563-67243585 TTTTTCAAATGAAAAGCCTGAGG + Intergenic
956360866 3:68445486-68445508 TTGTTCAATATAAATATCTATGG - Intronic
956422764 3:69101647-69101669 TTTCTCAAATGAAGAAGCTAAGG - Intronic
957304039 3:78432875-78432897 TTCTACAAATGAAAGATCTGTGG - Intergenic
957576937 3:82020049-82020071 GTGTTACAATGAAAACTCTAAGG - Intergenic
957647970 3:82958971-82958993 ATGTTCAAATAAAAATTCTTAGG + Intergenic
957711933 3:83872523-83872545 TAATTCAAATTAAAAATATATGG + Intergenic
958132333 3:89443857-89443879 TTGGTCAAATGTAAACTCTTTGG - Intronic
958584296 3:96067310-96067332 TAGTACAAATTAAAAATCTACGG - Intergenic
958668339 3:97169740-97169762 TTATTCAAATGAAAAAACTAAGG - Intronic
958726587 3:97913056-97913078 TTTTTCAAGTGAAAAATAGAAGG - Intronic
959427651 3:106212150-106212172 TTTTTCAGATGAAAAAACTTAGG + Intergenic
959474845 3:106797284-106797306 TTACTCAAGTGAAAAATTTAAGG + Intergenic
959632741 3:108527131-108527153 TTGTTCAAATGCAACTTCTCAGG - Intronic
959725558 3:109538081-109538103 TTGTATAAATGAAGAAACTAGGG - Intergenic
960042418 3:113164020-113164042 TTGTTCAAATGAAATAGCCTAGG + Intergenic
960421658 3:117453854-117453876 TTATTCAATTTAAAAATATATGG - Intergenic
960446722 3:117758303-117758325 TTCCTCATATGAAAAAACTATGG - Intergenic
960574905 3:119219804-119219826 TTGTTCAAATGTTATATTTAAGG - Intronic
960826270 3:121788146-121788168 TTTTACAAAAGAAAAAACTAAGG + Intronic
960842744 3:121977028-121977050 TTGTTAAAATGCAAATTCTCAGG - Intergenic
962041955 3:131716779-131716801 TTTTTCAAATGAAGAAACTGAGG + Intronic
962434555 3:135353421-135353443 TTGTTCATCTGGAAAATCTCAGG + Intergenic
962561842 3:136614339-136614361 CAGTACAAATGAAATATCTATGG + Intronic
962982209 3:140500720-140500742 TTCTACAAATGAAAAAAGTAAGG - Intronic
963400681 3:144793551-144793573 TTGGGCAAAAGAAAAATATAAGG + Intergenic
963585210 3:147178079-147178101 TTGATAAAATGAAACATTTAAGG - Intergenic
963886070 3:150584354-150584376 TTTTATAAATGAAAAAACTAAGG + Intronic
964897880 3:161620220-161620242 GTGTTCAAATGAAAAGACTTTGG + Intergenic
965033102 3:163399143-163399165 TTTTTCAAATGAATAACCTTTGG + Intergenic
965636013 3:170781657-170781679 TTTTTCAAATGAAGAAGCGAAGG + Intronic
965832828 3:172814155-172814177 TTGTTCAAATGACAAAATTAGGG + Intronic
965885053 3:173435208-173435230 TTGTTCAACAGAAAAATCAATGG - Intronic
965946802 3:174252595-174252617 TTTTTCAAATGAGAAAACTGAGG - Intronic
965981683 3:174699529-174699551 TTGGTCAAATTAGAAATGTATGG - Intronic
965994117 3:174858004-174858026 TTTTTCAAATTAAAAAGCAATGG + Intronic
966405079 3:179588544-179588566 TTATTCAAATTCAAAAACTACGG + Exonic
967159770 3:186725454-186725476 TTGTTAAAATCAAACATCAAAGG - Intronic
967354229 3:188550158-188550180 TTGTTCCATTAAAAAATTTATGG - Intronic
967612110 3:191519623-191519645 TTGTCAAAATGAAAACTATATGG + Intergenic
967715226 3:192754726-192754748 TTGTTGAAATGCATATTCTAGGG - Intronic
970333464 4:15005623-15005645 TTGGTCAACTGAAAAAGTTATGG - Intronic
970700526 4:18731776-18731798 TTACTCAAAAGAAAAATCTGGGG - Intergenic
971144530 4:23962354-23962376 TTCTACAAATGAGAAAGCTAAGG + Intergenic
971689822 4:29818830-29818852 TTCTTGAAATAAAAAAGCTATGG - Intergenic
972823138 4:42725219-42725241 TTATTCAGATGAAAAATCTGAGG + Intergenic
973053636 4:45627354-45627376 TATTTCAAATGTAAAATGTATGG - Intergenic
974538353 4:63198457-63198479 AATTACAAATGAAAAATCTATGG - Intergenic
974835813 4:67249412-67249434 TTGTTCATATGAACTATCTTGGG - Intergenic
975383862 4:73732502-73732524 TTTTACAAATGAAAAACCTGAGG + Intergenic
976286020 4:83371836-83371858 TTGTTCAAATGCAAAGTTTGAGG + Intergenic
976541628 4:86284209-86284231 TTTTACAAATAAAAAAACTAAGG + Intronic
976644133 4:87369734-87369756 TTATTTAAAAGAAAAATCTGGGG - Intronic
976693888 4:87897843-87897865 TTTTTCAGATGAGAAAACTAAGG - Intergenic
976822486 4:89222169-89222191 TTTTTTAAATGAAAGAGCTAGGG + Intergenic
977128888 4:93208342-93208364 TTGTCCAAATGAATAAACTGAGG - Intronic
977297125 4:95223175-95223197 TTTTTGAAATGAAAAACCTATGG + Intronic
977504609 4:97886441-97886463 TTGTCAACATGCAAAATCTAAGG + Intronic
977748264 4:100577468-100577490 TTGTTCAGATCAAATATCAAGGG - Intronic
978074188 4:104508644-104508666 TTGCTCAGATCAAAAATCTTGGG + Intergenic
978790215 4:112655335-112655357 TTTTTAAAATGAAAAATAAAAGG - Intronic
978936799 4:114387711-114387733 TTTTATAAATGAAGAATCTAAGG + Intergenic
979077106 4:116285668-116285690 TTCTTCAAAAAAAAAATCTCAGG - Intergenic
979308848 4:119178518-119178540 TTGCTCACATAAACAATCTACGG + Intronic
980220436 4:129906542-129906564 TTTTTCAAATGAAAAACTAAAGG - Intergenic
980241935 4:130189233-130189255 TTGGTAAAATGAAAAATATAAGG + Intergenic
980768433 4:137338908-137338930 TTGTTCAAATACAAAATTTGGGG + Intergenic
981665729 4:147223913-147223935 TTGTTCAAATGAAATTCCAATGG + Intergenic
982729582 4:158941810-158941832 TGGTTCCAAAGAAAAATCAAGGG + Intronic
982958155 4:161798109-161798131 TATTTCAGATGAAAAATTTATGG + Intronic
983212087 4:164969176-164969198 TTATTCAAATTAAAAAAATATGG - Intronic
983454858 4:167951366-167951388 TTGTTCTAAGGGAAAATATAGGG + Intergenic
983577526 4:169274529-169274551 TTGTTCAAACTAGAAACCTAGGG + Intergenic
983864855 4:172753843-172753865 TGGTTCAAAAAAAAAATCTGTGG + Intronic
984082538 4:175265932-175265954 ATGATCAAATAAAAAATCCAAGG + Intergenic
984364724 4:178784207-178784229 TTGTGAAAAAGAAAAATATAGGG + Intergenic
984513409 4:180708045-180708067 TTATACAAATGAAAATTCCAGGG - Intergenic
984531500 4:180922074-180922096 TTGCCCAAATGAAAAACCTATGG + Intergenic
984550236 4:181150584-181150606 TTTTTCAAATGAGAAAACTGAGG - Intergenic
984683519 4:182639481-182639503 TTTTTTAAAAGAAAAATCTTAGG + Intronic
985166681 4:187102878-187102900 TTTTTCAAATGAGAAAAATATGG + Intergenic
986881129 5:12172996-12173018 TTGTTGAATTAAAAAATATATGG + Intergenic
987285661 5:16454178-16454200 TATTTCAAATAAAAAAACTATGG + Intronic
987376635 5:17241458-17241480 TTGTACAAATGAAGAAACTGTGG + Intronic
987972767 5:24970845-24970867 TTATTGATATAAAAAATCTAAGG - Intergenic
988402790 5:30783457-30783479 TTGTTTAAATGAATAATTAAAGG - Intergenic
989502651 5:42186848-42186870 TTTTGGAAATAAAAAATCTAAGG - Intergenic
989635862 5:43532622-43532644 TTGTTCACATTAAAACTCAAAGG + Intronic
989744790 5:44815915-44815937 TTGTTCAAAGGAGAAAAATAAGG + Intronic
989800380 5:45531157-45531179 TGTTTCACATGAATAATCTATGG + Intronic
990989060 5:61667590-61667612 TTATTCAAATGAAAACTCTTGGG - Intronic
992302555 5:75398760-75398782 CTGTTCATATGCTAAATCTATGG - Intronic
992583375 5:78205645-78205667 TTGTTGGAATTAAAAATTTAGGG - Intronic
992604852 5:78444894-78444916 TTTTGCAAATGGAAAATCTCAGG + Intronic
992920509 5:81511963-81511985 ATGTGGAAATGAAAAATGTATGG + Intronic
992949746 5:81847128-81847150 TTTTTTAAAAGAAAAATTTAGGG - Intergenic
992998537 5:82356803-82356825 TGGTTCACATAAAAAATGTAGGG - Intronic
993026971 5:82658445-82658467 TTGTTAAAATGAAAAACCCTTGG - Intergenic
993198194 5:84777436-84777458 TTTTTCACATGAATATTCTATGG + Intergenic
993508199 5:88737168-88737190 TTGTTAAATTGAAACATCAAGGG + Intronic
993515761 5:88832659-88832681 TTGTTCAAAATCTAAATCTATGG - Intronic
993571470 5:89544872-89544894 TTATTCAAATGGAAAAACTAAGG + Intergenic
993598168 5:89885819-89885841 TGGGTCAAAAAAAAAATCTAAGG + Intergenic
993640927 5:90404392-90404414 TTCTACAAATAAACAATCTAAGG + Intronic
993737720 5:91497834-91497856 GTGTTCAGATGCAAAATATAAGG + Intergenic
995200243 5:109416877-109416899 TTGATAAAATGACAAATCTCTGG + Intergenic
995406712 5:111806121-111806143 TTTTTCAAAATAAAAAGCTAGGG + Intronic
996354508 5:122580977-122580999 TTTTTCCATTGAAAAATCAAAGG - Intergenic
996422726 5:123279858-123279880 TTTTTCAAATGAGAAAGCTGAGG + Intergenic
996834283 5:127773921-127773943 TTTTTCAAATGGAAAATAAAAGG - Intergenic
996981360 5:129499575-129499597 TCCTACAAATGAAAAATATATGG - Intronic
997143192 5:131405238-131405260 TTGTACAAGTGCAAAATGTAAGG + Intergenic
997929384 5:138059834-138059856 ATGTTCAAATGAAATATGTTTGG + Intergenic
998123521 5:139599399-139599421 TTTTTCAAAAAAAAAATTTAAGG - Intronic
998161932 5:139817914-139817936 TTTTTCACATGAAGAAACTATGG + Intronic
998405294 5:141870805-141870827 TTATTCAAATCCAAAATCTTTGG + Intronic
998594610 5:143515848-143515870 AGGCTCAAATGAAAGATCTAGGG - Intergenic
999030673 5:148287549-148287571 TTGCAAAAGTGAAAAATCTAGGG - Intergenic
999112355 5:149132935-149132957 TTTTTCAAATGAAGAAACTGAGG - Intergenic
999204678 5:149839640-149839662 TTTTCCAGATGAAAAATCTGAGG - Intronic
999438737 5:151584706-151584728 TTTTACAAATGAAAAAACTGAGG + Intergenic
1000310124 5:160034696-160034718 TTTTTGAAATGAAGAAACTAAGG + Intronic
1000475636 5:161703535-161703557 ATGGTTAAATGAAAAAGCTAGGG - Intergenic
1000532694 5:162443787-162443809 TTTTACAAATGAAAAAACTGAGG + Intergenic
1000570376 5:162905357-162905379 TTTTCCAAATGAAAAACCTGAGG + Intergenic
1000728078 5:164797372-164797394 TTGCACAAATGAATAATCAATGG + Intergenic
1001528911 5:172448733-172448755 TTTTACAAATGTAAAAACTAAGG + Intronic
1001970391 5:175950632-175950654 TTTTACAAATGAAAAAACTAAGG + Intronic
1002247046 5:177893129-177893151 TTTTACAAATGAAAAAACTAAGG - Intergenic
1002783960 6:387114-387136 TTGTTCAAATGAGATATCCATGG - Intergenic
1003488947 6:6604434-6604456 TTGTTGAAATGAAAAAATAATGG + Intronic
1003783727 6:9459285-9459307 TTGTGCAAATTAAAGATTTAGGG - Intergenic
1004130111 6:12911662-12911684 TTGTTTAAAAAAAAAATCCAGGG + Intronic
1004391051 6:15210065-15210087 GTGTGCAAATGAATAATATATGG + Intergenic
1005213551 6:23497824-23497846 TCCTACAGATGAAAAATCTATGG - Intergenic
1005367748 6:25096315-25096337 TTGTTCAAATGTACTATCTGTGG + Intergenic
1005744137 6:28820613-28820635 TTGTTGAAATGAAACGCCTAGGG - Intergenic
1005783109 6:29214532-29214554 TTTTCCAAATACAAAATCTAAGG + Intergenic
1006255010 6:32825430-32825452 TTTTTTAAATTAAAAATATATGG - Intronic
1006928165 6:37670506-37670528 TTTTGCAAATGAGAAAACTAAGG - Intronic
1008001042 6:46360100-46360122 TTGTTAAAATGAAAATTCTAGGG + Intronic
1008386705 6:50899998-50900020 TTTTTCCAATGAGAAAACTAAGG - Intergenic
1008405181 6:51111231-51111253 TTTTGCAAATGAAGGATCTAAGG + Intergenic
1008453842 6:51685367-51685389 TTCTTCAACAGAAAAGTCTATGG + Intronic
1008490323 6:52079616-52079638 TTTTACAAATGAACAATCTGAGG - Intronic
1008910306 6:56725069-56725091 TTTTACAAATGAGAAAACTAAGG + Intronic
1009442164 6:63693825-63693847 TAGTTCAACATAAAAATCTAGGG - Intronic
1009887192 6:69638082-69638104 TTTTTCAAAGGACAAATCCAAGG - Intergenic
1010044539 6:71425833-71425855 TTGTTCAAACAAAAAGTTTACGG + Intergenic
1010456415 6:76061235-76061257 ATGTACAAATGAACAATCTGTGG - Intronic
1010478128 6:76315061-76315083 TTTTGCAAATGAGAAAACTAAGG + Intergenic
1010886036 6:81242010-81242032 TTTTTTAAATGAAAAGCCTAGGG - Intergenic
1010980045 6:82362004-82362026 TTGTACAAATGAAAAAACTGGGG - Intergenic
1011350846 6:86422098-86422120 TTTTGCAAATGAAGAATCCAGGG - Intergenic
1012185679 6:96212946-96212968 TTTTACAGATTAAAAATCTATGG - Exonic
1012199459 6:96387372-96387394 TTGTTAAAATGAAGATTCTTGGG + Intergenic
1012589699 6:100966231-100966253 TTGTACAAATGAGAAAGCTGAGG - Intergenic
1013468625 6:110440451-110440473 TTTTTCAAATGGAAAATACAAGG + Intronic
1013844785 6:114436458-114436480 TTACACAGATGAAAAATCTAAGG - Intergenic
1014050666 6:116950027-116950049 TTGTTCAAATTAAACAGCTATGG - Intergenic
1015062892 6:128988808-128988830 TTGTTTAAATGAACAATTTTAGG - Intronic
1015370329 6:132443696-132443718 TTTTACAGATGAGAAATCTAAGG - Intergenic
1015646394 6:135393835-135393857 GTTTTCAAATGAAGAGTCTAAGG + Intronic
1016156554 6:140817181-140817203 TTGAACAAATGAACAATATATGG - Intergenic
1016482414 6:144495929-144495951 CTGTTCAATTTAGAAATCTAAGG - Intronic
1016528071 6:145025896-145025918 TTCTTTAAATGAAAATTCCATGG + Intergenic
1016547985 6:145245664-145245686 TTTTTCAAATGCAAAAGCTAGGG + Intergenic
1017195305 6:151694130-151694152 TTGTACAAATGAGGAAACTAAGG + Intronic
1017243888 6:152200875-152200897 TTCTTCAGTTGTAAAATCTAAGG - Intronic
1017611474 6:156190939-156190961 ATTGTCAAATGAAAAAGCTAAGG - Intergenic
1017738844 6:157386878-157386900 TTTTTAAAATAAAAAATCTTTGG + Intronic
1018702642 6:166439406-166439428 TTGATTAAAAGAAAAATATATGG - Intronic
1020109998 7:5442705-5442727 TTTTTTAAATGAAAAATAAAAGG + Intronic
1020347442 7:7181442-7181464 TTTTTCAGATGACAAAACTAAGG - Intronic
1020673700 7:11153331-11153353 TTGTTCAAACACAAACTCTAGGG - Intronic
1021111595 7:16700590-16700612 TTGTTAAAATGAAAATTCTCAGG - Intronic
1021161166 7:17274512-17274534 TTTTTCAAATGAAGAAACTGAGG + Intergenic
1021449654 7:20771469-20771491 TTACTGAAATGGAAAATCTATGG + Intronic
1022053487 7:26703609-26703631 TTGTCCAGATGAAAAAACTGAGG - Intronic
1022251248 7:28610605-28610627 TTCTTCAAATGAAAAATGGATGG + Intronic
1022355107 7:29607212-29607234 TCATTTAAATGAAAAGTCTAGGG + Intergenic
1022944415 7:35267823-35267845 TTGTTGAAATGCAGAATCTCTGG - Intergenic
1024331210 7:48157112-48157134 TTTTACAAATGCAAAAACTAAGG - Intergenic
1024411303 7:49045390-49045412 TATTCCAAATGAAAAAACTAAGG - Intergenic
1024430786 7:49285764-49285786 TTTTTCAGATGAACAGTCTAGGG + Intergenic
1024476138 7:49813406-49813428 TTGTTAAAATGCAAATTCTCAGG - Intronic
1024829220 7:53428329-53428351 TTGGTCAAGTGAAAAATAAAGGG + Intergenic
1024844195 7:53622523-53622545 TTCTTCCCATGGAAAATCTATGG + Intergenic
1024904512 7:54361429-54361451 TTGTTGAAATGAAAATTCTTAGG - Intergenic
1025149320 7:56536633-56536655 TTCTTCAGAAGAAAACTCTAAGG - Intergenic
1025297444 7:57787348-57787370 TTCATCAAATGTAAAAACTATGG - Intergenic
1025721877 7:64024558-64024580 TTGTTAAAATTAAAAATGTGAGG + Intergenic
1026331008 7:69352492-69352514 TTTTTGAAATGAGAAATCTGGGG + Intergenic
1026848923 7:73712782-73712804 TACTTAAAAAGAAAAATCTAGGG - Intronic
1026977014 7:74505218-74505240 CTTTACAAATGAAAAATCTCGGG + Intronic
1027344779 7:77246812-77246834 TTGTACAAATGAAGAAACTGAGG - Intronic
1028154528 7:87414749-87414771 TATTACAAATGAAAAATCTATGG - Intronic
1028402933 7:90443953-90443975 TTTTACAAATGAAGAAACTAAGG + Intronic
1028851302 7:95541208-95541230 TTTTACAAATGAAAAAACTGAGG - Intergenic
1028927570 7:96375863-96375885 CTGTTCAAATGAATACTATATGG + Intergenic
1030505287 7:110414309-110414331 TTTTTTAAATGAAAATTCCACGG + Intergenic
1030655579 7:112163706-112163728 TTTTACAAATGAAGAAACTAAGG + Intronic
1030877469 7:114832933-114832955 TTATTCAAATGTGAAATATATGG - Intergenic
1031626487 7:123998402-123998424 TAGTGCAAAAGAAAAATTTAGGG + Intergenic
1033335140 7:140445875-140445897 TTTTGCAAATGAAAAAACTAAGG - Intergenic
1033602896 7:142901449-142901471 TTTTTCAAAGGAGAAATTTAGGG + Intergenic
1033831027 7:145252792-145252814 TTGCTCAAATGAAGAAACTGAGG - Intergenic
1033996829 7:147360621-147360643 TTTTTCAAAAGAAATATTTATGG - Intronic
1034008640 7:147503985-147504007 TTTTTCAGATGAAAAAGCTGAGG + Intronic
1034129500 7:148701796-148701818 TTCTTCAAATTAAAAATATTAGG + Intronic
1034921417 7:155086026-155086048 ATATACAGATGAAAAATCTAAGG - Intergenic
1035938739 8:3872448-3872470 CTGTGCAAATGAAAAAGCTGTGG + Intronic
1036797638 8:11767892-11767914 TTGTTTAAATGCAGATTCTAAGG - Intergenic
1036828156 8:11995911-11995933 TTTTTCAAATGAAGAAACTAAGG + Intronic
1037531994 8:19785758-19785780 TTTTGCAGATGAAAAAACTAAGG - Intergenic
1037656732 8:20890078-20890100 TTTTTCAGATGGAAAAACTAAGG + Intergenic
1038033716 8:23668029-23668051 ATTTTCAGATGAAAAAGCTAAGG - Intergenic
1038033723 8:23668176-23668198 ATTTTCAGATGAAAAAGCTAAGG + Intergenic
1038056360 8:23861916-23861938 TTGTTCAAAAGGAAAAAGTAAGG - Intergenic
1038129347 8:24712233-24712255 TTTTACAGATGAAAAAACTAAGG - Intergenic
1038318332 8:26507126-26507148 TTCTTAAAAAGAAAAATCAAGGG + Exonic
1038548076 8:28441433-28441455 CTGTTAAAATTAAAAATATAGGG + Intronic
1039130192 8:34255057-34255079 TTGTTAAAATGCATATTCTAGGG - Intergenic
1039130897 8:34262951-34262973 CTTTTCAGATGAAAGATCTAAGG - Intergenic
1039269470 8:35865199-35865221 CTGTTCAAATTAAAAGTATAAGG - Intergenic
1039281608 8:35991421-35991443 TAATTCAAATGAACAATCTAAGG - Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1039635600 8:39161325-39161347 TTGTTCCAATAAATATTCTAGGG - Intronic
1039913514 8:41843184-41843206 TTGCACAAATAAAAAATTTAAGG - Intronic
1039930053 8:41978375-41978397 TTTTTCAAAGGAAGAAACTAAGG - Intronic
1041754228 8:61295786-61295808 TTTTTCAAATGAGGAAACTAAGG - Intronic
1041966780 8:63687295-63687317 TATTTCAAATGAAAAATAAATGG - Intergenic
1042035622 8:64530754-64530776 TTGTTTAAATGAAATGTTTATGG - Intergenic
1042584679 8:70322670-70322692 TTTTACAAATGAAGAAACTAAGG - Intronic
1042669371 8:71244941-71244963 TTTTTAAAATTTAAAATCTAGGG + Intronic
1042845018 8:73160996-73161018 TTGTGAAAATGGAAAATGTAGGG + Intergenic
1043054448 8:75419931-75419953 TTGTTCAACTGAAGATTCTCAGG - Intronic
1043718975 8:83520584-83520606 TTTCTCAAATGAAAAATGTAGGG + Intergenic
1044059195 8:87613606-87613628 TTATTCATATGAAAAATAGAAGG + Intronic
1044422767 8:92017147-92017169 TTCTGCAAATGAAAAATCAAGGG - Intronic
1045075717 8:98565072-98565094 TTGCTCAAATTAAAAAGCAAAGG - Intronic
1045320210 8:101076830-101076852 TTTTTCAATTGAGAAAACTAAGG + Intergenic
1045730807 8:105238733-105238755 TTGTTAAAATGCAAAATCTTGGG - Intronic
1046023628 8:108696318-108696340 TATTGCAAATGAAAAATCTGAGG + Intronic
1046083236 8:109398011-109398033 TTCTTCAAATGAAAAAAAAAGGG - Intronic
1046108617 8:109694386-109694408 TAATTCAAATCTAAAATCTAGGG - Intergenic
1046277314 8:111980909-111980931 TTATTCAAAAGAACTATCTATGG + Intergenic
1046289865 8:112144274-112144296 TTTTTCAAAGGAAAAAACTGAGG + Intergenic
1046313678 8:112472774-112472796 TTCTTCATATAAAAAATATATGG + Intronic
1046415012 8:113902050-113902072 TTTTTCAGATGAAGAATCTGAGG + Intergenic
1046695538 8:117335302-117335324 TTGTACAAATGACAAAAGTAAGG - Intergenic
1046801523 8:118433612-118433634 GGGTTAAAATGAAAAATCAATGG + Intronic
1046907588 8:119590331-119590353 TTTTTCAGATGAAAAAACTGAGG + Intronic
1047567700 8:126063470-126063492 TTGTACAAATAAAAAACCCAAGG - Intergenic
1047636711 8:126771386-126771408 TTGTACAAATGAAGAAACTGAGG - Intergenic
1047993004 8:130306120-130306142 TTCTTTATATGAAAAATTTATGG - Intronic
1048356651 8:133659394-133659416 TTGCTGAAATGAAAACTCCAAGG + Intergenic
1048511934 8:135070789-135070811 TTTTACAAATGAAAAAACTGAGG - Intergenic
1048678909 8:136816476-136816498 TTTTTCAAATAAAAAAACTGAGG + Intergenic
1048825084 8:138416671-138416693 TTGCTCAAAAGTAAAATCTTTGG - Intronic
1050014094 9:1215044-1215066 TTTTTAATATAAAAAATCTAGGG - Intergenic
1050150447 9:2614515-2614537 TTTTTCAGATGAAAAAACTAAGG + Intergenic
1050230484 9:3519605-3519627 TTTTTCAAATGAGAAAACTGAGG + Intronic
1050301956 9:4268194-4268216 TTTTACAAATGAAAAAACTAAGG - Intronic
1051014322 9:12457407-12457429 TTTTTCATATGAGAAAACTAAGG - Intergenic
1051189995 9:14501491-14501513 TTTTACAGATGAAAAAGCTAAGG - Intergenic
1051212575 9:14760131-14760153 TTTCACAAATGAAGAATCTAAGG + Intronic
1051213957 9:14776310-14776332 TGACTCAAATGAAAAATCAAGGG + Intronic
1051351096 9:16198547-16198569 TTTTACAGATGAAAAATCTAAGG + Intergenic
1051686577 9:19664476-19664498 TTGTATAAATGAGAAATCCAAGG + Intronic
1051734166 9:20181231-20181253 TTTTTCAGATGAGAAAACTAAGG - Intergenic
1051833288 9:21305690-21305712 ATGAGCAAATGAAAATTCTAAGG + Intergenic
1052602494 9:30653282-30653304 TTTTTCACATGAGAAATCGAGGG - Intergenic
1053380242 9:37643577-37643599 TTTTTAAAATCAAAAATGTAAGG - Intronic
1053796167 9:41728687-41728709 TTCATCAAATGTAAAAACTATGG + Intergenic
1054149014 9:61586182-61586204 TTCATCAAATGTAAAAACTATGG - Intergenic
1054184573 9:61940757-61940779 TTCATCAAATGTAAAAACTATGG + Intergenic
1054468780 9:65517293-65517315 TTCATCAAATGTAAAAACTATGG - Intergenic
1054653933 9:67647739-67647761 TTCATCAAATGTAAAAACTATGG - Intergenic
1054898864 9:70346014-70346036 TTGTTCAGGTGAAAAATTTAGGG - Intronic
1055028865 9:71751652-71751674 TTTTTAAAATGTAAAATCCAGGG - Intronic
1055212155 9:73809348-73809370 TTGTTTAAAAGAAAAATCAAGGG + Intergenic
1055390313 9:75814704-75814726 ATGTTCAAATTAAAAAATTAAGG + Intergenic
1055722284 9:79188820-79188842 GTTTTCAAATGACAAATCTGAGG + Intergenic
1056107238 9:83359375-83359397 TTGTTCAAATGACAAACTTGAGG - Intronic
1056347318 9:85711230-85711252 TTGTTCAGATGAGAAAACTGAGG + Intronic
1057465043 9:95305569-95305591 TTGTTCAATTAAAAAATAAAAGG - Intronic
1057530998 9:95846611-95846633 TTGTTAAAATGCAGAATCTCAGG + Intergenic
1057928409 9:99172384-99172406 TCGTTAAAATGAAAAAGCTGAGG - Intergenic
1058611674 9:106783831-106783853 TTTTACAAATGAAACAACTAAGG + Intergenic
1058703215 9:107618098-107618120 TTTTACAAATGAAAAAACTGAGG - Intergenic
1058851834 9:109019662-109019684 TGGTTGAAGTGAAAAATCTCAGG - Exonic
1058857613 9:109079359-109079381 TTGCTCAAATGGAAAGTCTCAGG - Intronic
1059023666 9:110602239-110602261 CTTCTCAAATGAGAAATCTAGGG - Intergenic
1059330389 9:113531782-113531804 TTTTTCAGATGAGAAAACTAAGG - Intronic
1059688473 9:116660822-116660844 TTTTACAAATGAACAAACTAAGG - Intronic
1059766450 9:117388173-117388195 TTGTGCAAATGAGAACTCTGAGG + Intronic
1059896327 9:118870043-118870065 ATTTTCAAATGAAGAAACTAAGG + Intergenic
1060288674 9:122279313-122279335 TGGTACAGATGAGAAATCTAAGG - Intronic
1060439613 9:123626610-123626632 TTGTTCAAATGAAAGCTTGAGGG - Intronic
1060482273 9:124023539-124023561 TTCTACAGATGAGAAATCTATGG - Intronic
1203432226 Un_GL000195v1:101618-101640 TTGCTTAAAGGAAAAATGTATGG + Intergenic
1203434268 Un_GL000195v1:122926-122948 TTGCTGAAAGGAAAAATGTATGG - Intergenic
1186022304 X:5269979-5270001 TTTTTAAAATGAAAAATGAATGG - Intergenic
1186103054 X:6177107-6177129 TTATTTAAATGAAAACTGTAAGG - Intronic
1186564162 X:10644550-10644572 TTTTTCATATGAAAAAGCAAGGG + Intronic
1186972141 X:14858716-14858738 TTTTACAAATGAAAAAACTGAGG + Intronic
1187664809 X:21594570-21594592 ATGTTCAGATGTAAAATATAGGG - Intronic
1188340940 X:29000709-29000731 TAGTTCAAAAGAAAAAAATAAGG - Intronic
1188373078 X:29392805-29392827 TATTTCAAATGAAAAGTATAAGG + Intronic
1188376165 X:29430507-29430529 TTGTTCAAAGGCACAATATAAGG + Intronic
1188531136 X:31142546-31142568 TTGTTCTAAATAAAAAGCTAGGG + Intronic
1188691748 X:33138040-33138062 TTTTTCAGATGAAGAAACTAAGG + Intronic
1189001207 X:36949197-36949219 TTGTTCAAAGGAAATATCATTGG - Intergenic
1189923845 X:45932161-45932183 TTGTGCAAATGAGAAAGCTGAGG - Intergenic
1192082164 X:68058973-68058995 TTATACAAATGAGAAAACTAAGG + Intronic
1192233615 X:69282710-69282732 TTGTTCAGATGAAGAAACTGAGG + Intergenic
1194182405 X:90729278-90729300 TTCTACAAATGAGAAAACTAAGG + Intergenic
1194430094 X:93792600-93792622 TTTTTCAAATTAAAAAGTTAGGG - Intergenic
1194909117 X:99617514-99617536 TTTTTAAAAAGAAAAATGTATGG - Intergenic
1195165634 X:102216884-102216906 TTTTTTAAATGAAAAATAAATGG + Intronic
1195193224 X:102470207-102470229 TTTTTTAAATGAAAAATAAATGG - Intronic
1195330069 X:103789961-103789983 TTGTGCAGATTAAAAACCTAAGG + Intronic
1196076650 X:111585376-111585398 TTTTGCAAATGAGAAAGCTAAGG - Intergenic
1196254725 X:113503617-113503639 TTGATCAATTGATAAATCTAAGG + Intergenic
1196967493 X:121073772-121073794 ATTTTCAAATAAACAATCTAAGG - Intergenic
1197102489 X:122672878-122672900 TTGCTCAAATCAGAAATCTCGGG + Intergenic
1197219740 X:123900392-123900414 TAGTTAAAATGAAAAAATTAAGG - Intronic
1197277881 X:124501057-124501079 TTATTAAAAAGAACAATCTAGGG - Intronic
1197482075 X:126999529-126999551 TTTTACAGATGAAAAAACTAAGG + Intergenic
1198131318 X:133698073-133698095 TTGTTCAAATGCCGAATCTATGG - Intronic
1199049027 X:143213481-143213503 TAGTACAAATGAACAATCTAAGG - Intergenic
1199100872 X:143798526-143798548 TTTTACAAATGGAAAACCTAAGG + Intergenic
1199328004 X:146524086-146524108 ATTCTCAAATGAAAAATATATGG + Intergenic
1199395163 X:147328407-147328429 TTCTACAACTGAAAAACCTATGG + Intergenic
1199467486 X:148155537-148155559 TTGTATAGATGAAAAAACTAAGG + Intergenic
1200529024 Y:4311236-4311258 TTCTACAAATGAGAAAACTAAGG + Intergenic
1200742514 Y:6869591-6869613 TTGTCCAAATGAGAAAACCAGGG + Intronic
1201492357 Y:14556191-14556213 TTATTTAAATGAAAACTGTAAGG + Intronic
1201637577 Y:16142202-16142224 TTTTTCATTTGAAAAATCTAAGG - Intergenic
1201650431 Y:16278605-16278627 TTGCTCAAATGCAAAATGAATGG + Intergenic
1201666107 Y:16457623-16457645 TTGTTTAAATCACAACTCTAGGG - Intergenic
1201749543 Y:17417747-17417769 TTGGCCAAATGAAAAACTTATGG + Intergenic
1201964790 Y:19720318-19720340 TTGTTGAGATGAAAAAACTGAGG + Intronic