ID: 1170142514

View in Genome Browser
Species Human (GRCh38)
Location 20:13139094-13139116
Sequence ATGGAGGAGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8243
Summary {0: 1, 1: 5, 2: 112, 3: 1086, 4: 7039}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170142514_1170142521 0 Left 1170142514 20:13139094-13139116 CCTCCCTCCTTCTCCTCCTCCAT 0: 1
1: 5
2: 112
3: 1086
4: 7039
Right 1170142521 20:13139117-13139139 CTTAATAATGATTTGCACTTAGG 0: 1
1: 0
2: 1
3: 13
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170142514 Original CRISPR ATGGAGGAGGAGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr