ID: 1170143400

View in Genome Browser
Species Human (GRCh38)
Location 20:13147561-13147583
Sequence ATAGAGAAGCAGGGAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1045
Summary {0: 1, 1: 1, 2: 6, 3: 76, 4: 961}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170143380_1170143400 28 Left 1170143380 20:13147510-13147532 CCCTCTGCCCCCTTGCCAAGCCA 0: 1
1: 1
2: 2
3: 32
4: 349
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961
1170143394_1170143400 -6 Left 1170143394 20:13147544-13147566 CCAGGGTAAACTGGCAGATAGAG 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961
1170143392_1170143400 8 Left 1170143392 20:13147530-13147552 CCAGGGGAAAAAGTCCAGGGTAA 0: 1
1: 0
2: 1
3: 9
4: 153
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961
1170143387_1170143400 19 Left 1170143387 20:13147519-13147541 CCCTTGCCAAGCCAGGGGAAAAA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961
1170143389_1170143400 13 Left 1170143389 20:13147525-13147547 CCAAGCCAGGGGAAAAAGTCCAG 0: 1
1: 0
2: 1
3: 18
4: 221
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961
1170143388_1170143400 18 Left 1170143388 20:13147520-13147542 CCTTGCCAAGCCAGGGGAAAAAG 0: 1
1: 0
2: 1
3: 26
4: 232
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961
1170143385_1170143400 21 Left 1170143385 20:13147517-13147539 CCCCCTTGCCAAGCCAGGGGAAA 0: 1
1: 0
2: 2
3: 24
4: 378
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961
1170143381_1170143400 27 Left 1170143381 20:13147511-13147533 CCTCTGCCCCCTTGCCAAGCCAG 0: 1
1: 0
2: 3
3: 43
4: 441
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961
1170143386_1170143400 20 Left 1170143386 20:13147518-13147540 CCCCTTGCCAAGCCAGGGGAAAA 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG 0: 1
1: 1
2: 6
3: 76
4: 961

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170143400 Original CRISPR ATAGAGAAGCAGGGAGGGGC AGG Intronic
900017433 1:162327-162349 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
900047692 1:520923-520945 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
900103414 1:972260-972282 ATACAGATGCTGTGAGGGGCTGG - Intronic
900323389 1:2095823-2095845 AAAGAGGAGAAGGGAGGGGAAGG - Intronic
900342941 1:2197289-2197311 ATGGGGGAGCCGGGAGGGGCTGG - Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
901023743 1:6268449-6268471 CTAGGGAAGAAAGGAGGGGCTGG - Intronic
901505267 1:9681156-9681178 AGAGAGAAGAGGGGAGGGGAGGG + Intronic
902114104 1:14106963-14106985 GGAGAGAAGGAGGGAGGGACGGG - Intergenic
902395313 1:16129329-16129351 AGAGAGGAGCATTGAGGGGCAGG + Intronic
902558955 1:17265057-17265079 AAGAAGAAGCAGTGAGGGGCAGG - Intronic
902623542 1:17664176-17664198 AGAGAGAGGCAGGGAAGGGAAGG + Intronic
902990573 1:20184855-20184877 ATTGAGAAGAAAGGAGAGGCTGG + Intergenic
903354936 1:22740796-22740818 ATCAGGAAGCAGGGAGGGGCCGG - Intronic
903471458 1:23590546-23590568 ATGGAGAAGCAGGGAGGAGGAGG + Intronic
903502207 1:23807087-23807109 ACAGAGAAGCACAGAGGAGCAGG + Intronic
903682278 1:25104970-25104992 ATGGAGAGGCTGGCAGGGGCTGG - Intergenic
903745127 1:25581686-25581708 ATGGAGACCCCGGGAGGGGCAGG + Intergenic
904201903 1:28825338-28825360 AGAGAGAGGCAGGGAGTGGCTGG + Intronic
904321093 1:29698236-29698258 GTGGAGGAGCAGGGCGGGGCTGG + Intergenic
904333972 1:29785122-29785144 ACAGAGAGAGAGGGAGGGGCAGG + Intergenic
904475133 1:30760014-30760036 ATCGGGGAGCAGGGACGGGCTGG - Intergenic
904584416 1:31572008-31572030 ACAGAGGAGCAGGAAGGGGCTGG - Intergenic
905035588 1:34916141-34916163 ATAGAGAAACAGGGAGAAACAGG + Intronic
905309939 1:37042385-37042407 ACAGAGATGCAGGGAGAAGCGGG - Intergenic
905535973 1:38722135-38722157 AAAGAGAAGAAGGGAGAGGAAGG + Intergenic
905867958 1:41386541-41386563 AGAGAGAAGACGGGAGGGGAAGG - Intergenic
905960884 1:42041200-42041222 ATCGTGAAGCAGGCAGGCGCAGG + Intergenic
906096559 1:43228167-43228189 CTGGAGAGGCAGGGAGAGGCTGG - Intronic
906294094 1:44638385-44638407 AGAGAGAAGGAGGCAGAGGCAGG + Intronic
906515796 1:46438200-46438222 ACAGAGAACCAGGCAGGGTCGGG + Intergenic
906919100 1:50044372-50044394 AGAGAGAAACAGGGCGGGACAGG + Intergenic
907288086 1:53395020-53395042 AGGGAGAAGCGGGCAGGGGCTGG - Intergenic
907342015 1:53741815-53741837 ATTGAAAGACAGGGAGGGGCCGG - Intergenic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907916201 1:58872228-58872250 ACAGAGAAACAAGGAGGGGATGG - Intergenic
907933308 1:59019777-59019799 CAAGAGATGCAGGGAGTGGCAGG + Intergenic
910235421 1:85030975-85030997 ATAGAGATACAGTGAGGGCCGGG + Intronic
910771978 1:90840004-90840026 ATAGGGAAGGAGAGAGAGGCTGG - Intergenic
910954048 1:92682106-92682128 ATAGAAAACCAGTGAGAGGCCGG - Intronic
911101983 1:94102497-94102519 TTAGAGAGGGACGGAGGGGCAGG - Intronic
911693481 1:100861884-100861906 ATAGAGAAGGAGAGAGGGCTGGG - Intergenic
912614449 1:111084121-111084143 AGAGAGAAGCATGAAGGGGGAGG - Intergenic
912701715 1:111882798-111882820 AGAGTCCAGCAGGGAGGGGCTGG + Intronic
912724777 1:112049281-112049303 ACAGAGAAGCAGGTAGGGTGAGG - Intergenic
912772030 1:112472981-112473003 AGAGAGAGGGAGGGAGGGGAGGG + Intronic
912788219 1:112624769-112624791 ATAGAGAAGTAGGGAGGAATTGG + Intronic
912812210 1:112803011-112803033 ACAAAGAAGCAGGCAGGGGCAGG - Intergenic
913026621 1:114849648-114849670 ATATAGAAGGATGGAGGGGGAGG - Intergenic
913163719 1:116167333-116167355 ATATTAAAGCAGGGAGAGGCAGG - Intergenic
914049042 1:144116127-144116149 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
914130142 1:144849318-144849340 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
914689141 1:150010385-150010407 TCTGAGAAGCCGGGAGGGGCGGG + Intronic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
914921314 1:151849461-151849483 CTAAAGAAGCAGGGAGGGAAGGG - Intronic
915095445 1:153459292-153459314 AGGGAGAAGCAGGGAGAGTCGGG + Intronic
915355954 1:155255273-155255295 CTAGAGAAGAGGGGAGGGGTCGG + Exonic
915449153 1:155992693-155992715 ATAAAGTAGCAGGGGGAGGCCGG + Intronic
915531545 1:156505113-156505135 AGAGAGAAGGAGGGAGGAGCTGG - Intergenic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916160562 1:161908530-161908552 TTAGAGAAACATGGAGGGGAGGG - Intronic
916230263 1:162534558-162534580 ATTGAGAAGCCTGGAGGGGCTGG + Intergenic
916412272 1:164558656-164558678 AAAGAAAAGCAGGGGTGGGCGGG + Intronic
916749946 1:167714555-167714577 GTGGAGGAGCAGGGAGGGACCGG - Intergenic
916779396 1:168008707-168008729 CTAGAGAGACAGGGAAGGGCAGG - Intronic
917147535 1:171908895-171908917 GTAGGGAAGGAGGGAGGGACAGG - Intronic
917732197 1:177885994-177886016 AGAGAGATGAAGGGAGTGGCAGG - Intergenic
918011432 1:180590561-180590583 ATAGAGAGGTAGGCAGGGGCTGG + Intergenic
918013223 1:180607258-180607280 CTTGAGAACCAGGGAAGGGCTGG + Intergenic
918200943 1:182266333-182266355 GTGGAGAAGCAGGGAGGTGCTGG + Intergenic
918437866 1:184534954-184534976 AAAGAGGAGCAGTGAGGGGCTGG + Intronic
918815959 1:189183536-189183558 ATAGACAAGAGGGGAGGGGTAGG - Intergenic
919753885 1:201054571-201054593 AAAGAGACGAAGGGAGGGGAAGG + Intronic
919777456 1:201203585-201203607 ATAGAGGAGCTGGGATGGGGTGG - Intronic
919829317 1:201529199-201529221 ATAGATAGACAGGGAGGGGATGG - Intergenic
919836136 1:201574775-201574797 AAACAGAGGCAGGGAGGGTCAGG - Intergenic
919895149 1:202004977-202004999 ATTCCGGAGCAGGGAGGGGCTGG + Intronic
919918504 1:202153885-202153907 ACAGGGCAGCAGAGAGGGGCTGG + Intronic
920111436 1:203590065-203590087 AAAGAGAAGCGGTGGGGGGCTGG - Intergenic
920177773 1:204113856-204113878 ATAGGGGAGCAGGTAGGGGCTGG - Intronic
920214359 1:204351353-204351375 GTAGAGAAGGTGGGAGGGGTCGG - Intronic
920298731 1:204975626-204975648 AGAGAGAAGCAGGGAGCTGGTGG - Intronic
920657408 1:207887162-207887184 TTAGAGAACAAGGGAGGAGCTGG + Exonic
920690307 1:208141659-208141681 AAAGAGAAGCAGGGAAGGCAGGG - Intronic
921399120 1:214700941-214700963 ATAGACAAGCAGAGAGGGAATGG + Intergenic
921925693 1:220708396-220708418 TCTGAGAAGAAGGGAGGGGCTGG + Intergenic
922105275 1:222508245-222508267 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
922265608 1:223980823-223980845 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
922427657 1:225514685-225514707 ATCCAGATGCAGGGAGGGGTGGG + Exonic
923274458 1:232384464-232384486 AGAGAGAAGAAGGGAGAGGGAGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
924347449 1:243085778-243085800 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
924453882 1:244202331-244202353 ATAGGGAAGAAGGGAAGGGAAGG + Intergenic
924571374 1:245240735-245240757 TTAGGGAAGCTGGGAGAGGCAGG + Intronic
924614183 1:245599045-245599067 GGAGAGCAGCAGGGAGAGGCGGG + Intronic
1063057052 10:2517056-2517078 ATAAGGAAGGAGGCAGGGGCAGG - Intergenic
1063161688 10:3423215-3423237 GCAGAAAAGCAGGGAGGTGCCGG - Intergenic
1063652236 10:7949184-7949206 ACAGAGAAAGAGGAAGGGGCTGG + Intronic
1064328471 10:14372581-14372603 ATGGAGGAGCAGCGAAGGGCTGG - Intronic
1064927711 10:20587844-20587866 ATAAAAAAGCAGGGATGGGGAGG + Intergenic
1065177687 10:23095418-23095440 GGAGGGAAGGAGGGAGGGGCAGG + Intergenic
1065247444 10:23773096-23773118 AGAGAAAAACAGGGATGGGCTGG + Intronic
1065697759 10:28395558-28395580 ATAGAGAAAGAGAGAGAGGCAGG - Intergenic
1065740335 10:28791521-28791543 AGTGAGAAGGAGGGAAGGGCTGG + Intergenic
1065771281 10:29081161-29081183 ATAGAGAAGGAGAGAGGGCTGGG + Intergenic
1066364327 10:34762237-34762259 AGAGAGAGGCAGGGAGGGAGAGG + Intronic
1066442216 10:35449632-35449654 AGAGAGAGGGTGGGAGGGGCAGG + Intronic
1066588454 10:36964541-36964563 ATAGAAAGGAAGGGAGGGGAGGG + Intergenic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1067434914 10:46270036-46270058 AAAGAGGAGCTGAGAGGGGCAGG + Intergenic
1067544860 10:47185264-47185286 AGAGAGGGGCAGGTAGGGGCAGG - Intergenic
1067764619 10:49075645-49075667 ATAGAGACACAGGCAGAGGCTGG + Intronic
1069569787 10:69487369-69487391 AAAGAGGGACAGGGAGGGGCAGG - Intronic
1069659235 10:70112658-70112680 AAAAGGGAGCAGGGAGGGGCAGG + Exonic
1069740082 10:70681840-70681862 CTAGAGACCCTGGGAGGGGCAGG + Intronic
1069920193 10:71811688-71811710 GGAGAGAAGCAGAGAGGGGCTGG - Intronic
1070765794 10:79055517-79055539 AAAAAGAGGCAGGGAGAGGCTGG + Intergenic
1070777511 10:79118461-79118483 ATGAACAAGCAAGGAGGGGCTGG + Intronic
1071384306 10:85104225-85104247 ATGGAGCAGCAGGGAGGGGCTGG - Intergenic
1073120527 10:101119905-101119927 ATGAGGAACCAGGGAGGGGCTGG - Intronic
1073358113 10:102873181-102873203 ATTGAGAAGTTGGGAGAGGCTGG + Exonic
1074101904 10:110360309-110360331 ATGGAGAGGCTGGGAGGGGCAGG - Intergenic
1074756633 10:116628450-116628472 AGAGAGAGGGAGGGAGGGGAGGG + Intronic
1074997832 10:118773117-118773139 ATAGATAAGAAGAGAGAGGCTGG - Intergenic
1075223634 10:120605459-120605481 ACAGAGAGGCAGAGAGGTGCTGG - Intergenic
1075561621 10:123472664-123472686 AGGGAGAAGCAAGGAGGGGATGG + Intergenic
1075687018 10:124371333-124371355 ATGGAGGAGCAAGGAGGAGCTGG - Intergenic
1075789174 10:125071189-125071211 AAACAGAGGCAGCGAGGGGCAGG + Intronic
1075901320 10:126044886-126044908 AGAGAGAAGCCATGAGGGGCAGG - Intronic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076369809 10:129945083-129945105 AGAGAGGAGAAGGGAGGGGAGGG + Intronic
1076621167 10:131789086-131789108 AGAGAGGTGCAGGGAGGTGCGGG + Intergenic
1076974029 11:157533-157555 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1077088333 11:765830-765852 ATTGAAAAACAGGGAGAGGCCGG - Intergenic
1077174403 11:1182079-1182101 ACAGAGCCGCAGGGAGGGGCGGG + Intronic
1077289574 11:1782656-1782678 ATTGGGTAGCAGGAAGGGGCAGG - Intergenic
1077506401 11:2931771-2931793 AGAGAGGAGCTGGGCGGGGCTGG - Intergenic
1077618775 11:3700057-3700079 TTAGAAAAGCAAGAAGGGGCCGG + Intronic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1078808783 11:14736697-14736719 ATAGAGAAGGAGAGAGGTTCTGG + Intronic
1078880914 11:15447997-15448019 ATAGATAAGCAGGGTTGGGCGGG - Intergenic
1078888973 11:15536592-15536614 ATAGAGAAGCACTGGGGAGCAGG - Intergenic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079502143 11:21113170-21113192 ACATACAAGCAGAGAGGGGCTGG + Intronic
1079661049 11:23036933-23036955 ATGGAGAGGGAGGTAGGGGCAGG + Intergenic
1079913628 11:26341080-26341102 GAAGAGAAGCGGGGAGGGGAGGG - Intronic
1080037185 11:27722068-27722090 AAAGCGCAGCAGGGAGGGGGTGG + Intergenic
1080321389 11:31014234-31014256 AAAGAGAGGAAGGGAGGGGAGGG - Intronic
1080530723 11:33173201-33173223 AGACAGAAGCTGGGAGGGCCAGG + Intergenic
1080886467 11:36372631-36372653 CAAGAGAAGCAGGGAGTGGCTGG + Intronic
1081061697 11:38486684-38486706 ATAGAGAGAAAAGGAGGGGCAGG + Intergenic
1081494815 11:43597929-43597951 AAAGAAAAGCAGGAGGGGGCTGG - Intronic
1081565117 11:44255943-44255965 ATAGAGATGCATGTTGGGGCAGG + Intergenic
1081998519 11:47379128-47379150 ATCAAGAAGCTGGGAGGGGAGGG - Intergenic
1082223911 11:49677728-49677750 AAAGAGAAGAGGGGAGGGGAGGG - Intergenic
1082806795 11:57457006-57457028 ATTCAGAAGATGGGAGGGGCTGG - Intergenic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1083293149 11:61700851-61700873 CTGGAGGAGCAGGGAGGTGCAGG - Intronic
1083549047 11:63572057-63572079 GGAGAGAAGGAGGGAGGGGAAGG + Intergenic
1083685296 11:64371665-64371687 ATAGAGTTGCAGGGAAGGGGGGG + Exonic
1083713103 11:64560644-64560666 TGAGGGAAGCAAGGAGGGGCTGG - Intronic
1083756766 11:64796218-64796240 GCAGAGGGGCAGGGAGGGGCTGG - Intronic
1083823718 11:65186716-65186738 ACAGAGGAGCAGGGAAGGGTGGG - Intronic
1084041784 11:66546814-66546836 ATGGGGGAGGAGGGAGGGGCCGG - Intronic
1084256237 11:67944751-67944773 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1084683081 11:70678470-70678492 AGGGAGAGGCAGGGAGAGGCAGG - Intronic
1084683084 11:70678480-70678502 GTCGAGAGGCAGGGAGAGGCAGG - Intronic
1084816524 11:71650552-71650574 GCAGACAAGCAGGTAGGGGCTGG - Intergenic
1084899073 11:72296055-72296077 ATAGAGAAGCAGTGAGATACAGG + Intronic
1084945024 11:72633736-72633758 ATAGTGAAGGAGAGAGGAGCTGG + Intronic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1086422804 11:86654159-86654181 CTAGAGATACAAGGAGGGGCTGG + Intronic
1087078828 11:94150703-94150725 AGAGCCAGGCAGGGAGGGGCAGG - Intronic
1087195642 11:95301792-95301814 AATGAGGAGCAGGGAGGGGAGGG + Intergenic
1087211826 11:95452894-95452916 AGAGAAAGGAAGGGAGGGGCTGG - Intergenic
1087773350 11:102235179-102235201 TTACAGAAGCAGGGAGAGTCTGG - Intergenic
1087929587 11:103961476-103961498 ATAGGGAAGCAGGCAGGTGAAGG + Intronic
1088022760 11:105139585-105139607 AGAAAGAAGAAGGGAGAGGCAGG - Intronic
1088086718 11:105990016-105990038 GTAGAGAATGAGGGAGGGACGGG + Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088766322 11:112982968-112982990 AGAGAGAAGCAGAGAGGACCAGG + Intronic
1088819867 11:113447943-113447965 ACTGACAAGCAGGGAGGGCCTGG - Intronic
1088858204 11:113775379-113775401 ATACAGTTGCAGGGAGGGGAAGG + Intergenic
1089076788 11:115744909-115744931 ATAAAAAAGTGGGGAGGGGCTGG - Intergenic
1089270742 11:117300020-117300042 AGGGGGAGGCAGGGAGGGGCAGG - Intronic
1089317839 11:117604419-117604441 GTGGAGAGGGAGGGAGGGGCAGG - Intronic
1089454449 11:118617892-118617914 ATAGAGCAGCAAGGAGAGGCAGG + Intronic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089617994 11:119705948-119705970 AGAGGGAGGCGGGGAGGGGCGGG + Intronic
1089850104 11:121488285-121488307 AGAGAGAAGGAGGGAGAGGCAGG - Intronic
1090236843 11:125154600-125154622 ATTGGGAAGCAAGGAGGGGTTGG + Intergenic
1090636271 11:128692383-128692405 ATTGAGAAGCAGACAGGAGCGGG + Intronic
1090818629 11:130320188-130320210 AGAGAGAAGAAGGCAGTGGCTGG - Intergenic
1090836427 11:130457596-130457618 ATCGTGAGGCAGGTAGGGGCTGG + Intronic
1091018080 11:132072329-132072351 GTAGGGAAGTAGGGAGGGGTAGG + Intronic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091218804 11:133918926-133918948 CTGGAGAAGGAAGGAGGGGCAGG + Intronic
1091294904 11:134466858-134466880 AGAGAGAAGGAGGGAGGGAGAGG - Intergenic
1091333212 11:134747081-134747103 ATGGCGAAGCAGGCAGGAGCTGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091899600 12:4134330-4134352 AGAGAGAGGCTGGCAGGGGCTGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092171242 12:6375189-6375211 ATAGAGAGGGAGTGAGAGGCAGG - Exonic
1092365430 12:7873059-7873081 GGTGAGAAGCCGGGAGGGGCCGG - Intronic
1092426469 12:8379482-8379504 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1092533812 12:9367507-9367529 ATGGAACAGCAGGGAGGGGGAGG + Intergenic
1092974980 12:13736126-13736148 ATAGAAAAGCGGGGGGGGGGGGG + Intronic
1093228221 12:16511736-16511758 AAAGAAAAGAAGAGAGGGGCTGG - Intronic
1093378348 12:18458866-18458888 AAAAGGAAGCGGGGAGGGGCTGG + Intronic
1093481013 12:19603911-19603933 ATAGATTAGAATGGAGGGGCAGG + Intronic
1094292435 12:28867042-28867064 GCAGAGAAGCAGGGTGGGTCTGG - Intergenic
1094492972 12:30972732-30972754 GTGGAGTAGCAGGGAGGAGCAGG + Intronic
1095446726 12:42289399-42289421 ATAGAGAAGAAGGGGAGGGGAGG - Intronic
1095458917 12:42420690-42420712 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1095709085 12:45269095-45269117 CCAGAGAAGAAGGGAGGGCCTGG - Intronic
1096419576 12:51445524-51445546 ACAGAAAAACAGGCAGGGGCAGG - Intronic
1096557644 12:52413250-52413272 AAAGATGAGCAGGCAGGGGCAGG - Intergenic
1096571985 12:52528804-52528826 GGAGAGAAGCAGGGAGAGGAGGG - Intergenic
1097156369 12:57015138-57015160 AAAGAGAAGAAGGAAGGGGTTGG + Intronic
1098077679 12:66750296-66750318 ACAGAGAAGCATGCTGGGGCAGG + Intronic
1098558956 12:71851173-71851195 ATAGAGCAGGAGGAAGGGGGAGG + Intronic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1100368614 12:93944190-93944212 ATAGAGAAGCATGTAGGGCTGGG - Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100565408 12:95790204-95790226 TTAGAGAAGCAGCGAGGGAAGGG + Intronic
1100641481 12:96485711-96485733 AGAGAGAGGAGGGGAGGGGCAGG - Intergenic
1100904732 12:99284810-99284832 TTAGAGGGGCAGGGAGGGGCCGG - Intronic
1101387170 12:104268150-104268172 AGAGAGAAAGAGGAAGGGGCCGG - Intronic
1101842627 12:108339353-108339375 GGAGAGCAGGAGGGAGGGGCAGG + Intergenic
1102394226 12:112574127-112574149 AAAGTGAAGGAGGGAGGGGGTGG + Intronic
1102548615 12:113674718-113674740 ACAGAGAAGGAGGGAGAGACAGG - Intergenic
1102595916 12:113992556-113992578 AGACAGAGGCAGGCAGGGGCAGG - Intergenic
1103862485 12:124025938-124025960 TTGGAGAAGCAGGGAAGGGATGG + Intronic
1104074164 12:125374644-125374666 ATAGAGAAGCCGGGGCGGGGCGG - Intronic
1104301654 12:127570124-127570146 ATAGAGAGGCAGGGGTGGGTGGG + Intergenic
1104491945 12:129201783-129201805 AGAGAGAAGGAGGGAGGGAGAGG + Intronic
1104609899 12:130219481-130219503 GTGGAGATGCAGGCAGGGGCTGG + Intergenic
1104846133 12:131847898-131847920 GTAGGGAACCAGGCAGGGGCAGG - Intronic
1104927892 12:132323006-132323028 GTGGAGAAGCCGGGAGGCGCTGG - Intronic
1104991518 12:132626353-132626375 ACAGAGCAGCAGGGAGGCCCCGG - Intronic
1105467547 13:20660155-20660177 CTAGAGAATGTGGGAGGGGCTGG + Intronic
1105815962 13:24036635-24036657 TTAGACAAGCAGGAAGGAGCAGG - Intronic
1105927325 13:25019209-25019231 ATGGAGAATCAGGGATGGTCTGG + Intergenic
1107409445 13:40144727-40144749 CTAGAGAAACAGGGAAGAGCTGG + Intergenic
1107666789 13:42699179-42699201 ATGGAGATGCAGGCAGGGTCAGG - Intergenic
1108221791 13:48241504-48241526 AAAGAGAAACATGGAGGGCCAGG - Intronic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1108758662 13:53534821-53534843 ATATAAAAGAAGGGAGGGGCCGG - Intergenic
1109932839 13:69238475-69238497 ATGGAGAAGCACAGAAGGGCAGG - Intergenic
1110924873 13:81138481-81138503 ATACAGAGGCAGGGAGTGACTGG + Intergenic
1111912406 13:94327384-94327406 ATAGAGAAGAAGAGAAGAGCTGG - Intronic
1112302205 13:98240450-98240472 TGAGAGAAGAAGGGAGGTGCAGG + Intronic
1113143872 13:107185385-107185407 AGAGGCATGCAGGGAGGGGCGGG - Intronic
1113609872 13:111636779-111636801 AGAAAGAAGCAGGGATGGGGCGG - Intronic
1113647190 13:112006929-112006951 AGAGAGAAGGAGGGAGGGAGAGG + Intergenic
1113871168 13:113560740-113560762 AGGCAGAAGCTGGGAGGGGCTGG + Intergenic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114467936 14:22937830-22937852 ATAGAGAAGGAGGGAGGCCTTGG - Intergenic
1115650356 14:35398674-35398696 AAAGAAAAGCAGGGAGGGCTGGG + Intergenic
1117325435 14:54664602-54664624 AGAGAGAAGAAGAGAGGGGGTGG - Intronic
1117859264 14:60073171-60073193 AAAGAAAAGCAGGGGGTGGCTGG + Intergenic
1118007106 14:61573274-61573296 ATAAAGAGGTAGGCAGGGGCTGG + Intronic
1118205610 14:63720366-63720388 AAAGAGACGGAGGGAGGGGAAGG + Intronic
1118902837 14:70001073-70001095 ACAGAGCACCAGGAAGGGGCTGG - Intronic
1119310915 14:73645405-73645427 GTCGAGATGCAGGGAGGGGCTGG + Intronic
1119897535 14:78232656-78232678 GAAGAGAAGCAGGGAGGGCTGGG - Intergenic
1119967819 14:78936518-78936540 CTAGAGGAGCAGGGAGAGGAAGG + Intronic
1120382058 14:83793234-83793256 AGAGAGAAGCAGGGAAGGAGTGG - Intergenic
1121009200 14:90510007-90510029 GCAGAGAGGCAGGGCGGGGCTGG + Intergenic
1121586230 14:95064810-95064832 AGAGAGAAGAAGGGAGGGGAGGG + Intergenic
1121651847 14:95564562-95564584 GTGGAGTAGAAGGGAGGGGCAGG - Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1121781802 14:96626715-96626737 ATGGAGGAGCAGGGAGGGATGGG + Intergenic
1122295923 14:100705745-100705767 ATAGGGATACAGGGATGGGCTGG + Intergenic
1122370747 14:101227714-101227736 AGGGAGAAGCAGGTCGGGGCAGG + Intergenic
1122381856 14:101313555-101313577 AGGGAGAAGCAGGTCGGGGCAGG - Intergenic
1122453614 14:101832688-101832710 ACAGAGGAGCAGGGTGGAGCGGG + Intronic
1122634900 14:103125231-103125253 AGGGGGAAGCAGGCAGGGGCTGG - Intronic
1122777005 14:104122552-104122574 AGAAAGAAGGAGGGAGGGGAGGG - Intergenic
1122799602 14:104223059-104223081 ATACCTCAGCAGGGAGGGGCAGG - Intergenic
1122808045 14:104270596-104270618 TTACAGACGTAGGGAGGGGCTGG - Intergenic
1122875394 14:104661979-104662001 TTACAGACGTAGGGAGGGGCTGG + Intergenic
1122967311 14:105137417-105137439 TTCTAGAAGCACGGAGGGGCTGG - Intergenic
1123388162 15:19840380-19840402 ACAGAGACGCAGGGAGGAGATGG + Intergenic
1123418979 15:20115700-20115722 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1123446885 15:20337807-20337829 ATAGAGCAGGAAGCAGGGGCGGG + Intergenic
1123528200 15:21122243-21122265 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1124037233 15:26065833-26065855 AAAGAGAAGCAGAGAGGAACTGG - Intergenic
1124521293 15:30408221-30408243 ATATAGAAGGAGAGAGGGCCCGG - Exonic
1124537369 15:30557996-30558018 ATATAGAAGGAGAGAGGGCCCGG + Exonic
1124761286 15:32449591-32449613 ATATAGAAGGAGAGAGGGCCCGG - Exonic
1124777348 15:32599472-32599494 ATATAGAAGGAGAGAGGGCCCGG + Exonic
1125542449 15:40477780-40477802 ATAAAGGAGAAGGGAGGAGCAGG + Intergenic
1126098329 15:45104700-45104722 GTAGACAGGCAGGAAGGGGCTGG + Intronic
1126288466 15:47043951-47043973 CAAGAGAAGCATGGGGGGGCAGG + Intergenic
1126654622 15:50963546-50963568 ATAAAGAAGCTGGGAAGGGTCGG + Intronic
1126675358 15:51155829-51155851 AGAGAGAGGAAGGGAGTGGCGGG - Intergenic
1126773076 15:52076943-52076965 ACACGAAAGCAGGGAGGGGCAGG - Intergenic
1128522845 15:68386896-68386918 TGAGAGAAGCAGGGAGAGGTGGG + Intronic
1128617866 15:69124249-69124271 TCAGAGGAGCAGGCAGGGGCTGG + Intergenic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1128666864 15:69544736-69544758 CTATAGAGGCAGGGAGGGGTTGG + Intergenic
1128710669 15:69869115-69869137 AAAGAGAAGTGGGGAGGGGAAGG - Intergenic
1129063423 15:72880589-72880611 AGACAGGAGCAGGGAGGTGCGGG + Intergenic
1129332531 15:74835103-74835125 ATTGAGAAGATGGGAGGGGCTGG - Intergenic
1129706509 15:77797667-77797689 ATCGAGCAGAAAGGAGGGGCTGG - Intronic
1129752687 15:78077152-78077174 GTGGAGAAGCAGGGAAAGGCAGG + Intronic
1129760320 15:78125423-78125445 AGAGAGAAGAGGGGAGGGGAAGG - Intronic
1129786359 15:78312829-78312851 AGAGAGCAGGAGTGAGGGGCAGG - Intergenic
1129887002 15:79045553-79045575 AGAGAGAAGCAGGCAGGAGGAGG - Intronic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1131066348 15:89437073-89437095 ATAGAGAGGAAGGGAGAGGAAGG - Intergenic
1131410776 15:92205966-92205988 ATTGAGAAACAGGGAGGGAGAGG - Intergenic
1131656950 15:94470898-94470920 ATCCAGAAGCAGGGAGAGGGAGG + Intronic
1131806830 15:96131457-96131479 ATACAAAAGCCAGGAGGGGCTGG + Intergenic
1132056293 15:98651860-98651882 TCAGAGATGGAGGGAGGGGCAGG - Intronic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132718000 16:1301597-1301619 GTGGAGCAGCTGGGAGGGGCAGG - Intergenic
1132818467 16:1847592-1847614 AAAGAGAAGAGGGGAGGGGAGGG + Intronic
1132866508 16:2095527-2095549 ATAGGGAGGCATGGAGTGGCAGG + Intronic
1132929346 16:2451018-2451040 AGAGAGAAGGGCGGAGGGGCCGG - Intronic
1133087429 16:3375848-3375870 AAAGGGAAGGAGGGAGGGGGAGG - Intronic
1133131822 16:3680807-3680829 ATACAGAAGGTGGAAGGGGCAGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133187904 16:4113863-4113885 ATGGAGCAGCTGGGAGTGGCCGG - Exonic
1133389776 16:5400387-5400409 AGAGAGAAGCAAGCAGTGGCCGG - Intergenic
1133420519 16:5642695-5642717 TTACAGAAGGAGGGAGGGGGAGG + Intergenic
1133454817 16:5932846-5932868 ATATGGGAGCAGGGAGTGGCGGG - Intergenic
1134110985 16:11515562-11515584 AAAGAGGAGAAGGGAGGGGAAGG + Intronic
1134401704 16:13915929-13915951 AGAGAAAAGTAGGGAGAGGCAGG + Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135088093 16:19490792-19490814 AAAGAGAGGGAGGGAGGGGAAGG - Intronic
1135149113 16:19989930-19989952 ATATAGAGGCAGAGAGGAGCTGG - Intergenic
1135713249 16:24736525-24736547 AGAGAGAAGCAGAAAAGGGCAGG - Intronic
1135973296 16:27087937-27087959 ACAGAGAAGCAGGGAGGTCAGGG - Intergenic
1136520401 16:30792036-30792058 AGAGAGGAGCTGGGAAGGGCAGG + Intergenic
1137031343 16:35527028-35527050 ATAGAGAGGCAGCCAGGGCCTGG - Intergenic
1137272695 16:46912739-46912761 AGAGAGAATCAGGGCGGGGCAGG + Intronic
1137534247 16:49305695-49305717 AGGGAGAGGAAGGGAGGGGCAGG - Intergenic
1137946244 16:52735572-52735594 ATAGAGAAGCCAAGAGGGGATGG - Intergenic
1138066121 16:53942980-53943002 AGGGAGAAGCAGGGAGGCACTGG + Intronic
1138137321 16:54534530-54534552 ATAGAGCAGAACAGAGGGGCAGG - Intergenic
1138327998 16:56191468-56191490 AGAGAGAGGCAGGGAGGGAGGGG - Intronic
1138605118 16:58083707-58083729 AGTGAGAAGCAGGGCAGGGCTGG + Intergenic
1138652832 16:58471608-58471630 ATTAAGAGGCAGGGAGGGGGTGG - Intronic
1139277088 16:65738011-65738033 ACAGGGAGGCAGGCAGGGGCTGG - Intergenic
1139349033 16:66323679-66323701 AAAGAGAAGCAGGGGAGGGAGGG - Intergenic
1140230276 16:73112214-73112236 ACAGAGAAGAAGAGAGGGGTGGG + Intergenic
1140236805 16:73166527-73166549 AGAGAGAAGCAAGGAAGGGCCGG + Intergenic
1140546709 16:75816772-75816794 AGAGAGAAGCAGGAAAGTGCAGG + Intergenic
1140728920 16:77838656-77838678 ACAGAGAGGCAGGGAGGGAAAGG - Intronic
1140904069 16:79395530-79395552 ACAGAGAGGCACTGAGGGGCAGG + Intergenic
1140978038 16:80079678-80079700 GTAGAGAAAGAGGGAGGGGGGGG - Intergenic
1141120578 16:81352236-81352258 AGAGAGAATAAGGGTGGGGCAGG - Intronic
1141141664 16:81500416-81500438 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1141326768 16:83067812-83067834 AGAGAGAAGAAGAGAGGGGCAGG - Intronic
1141510660 16:84509811-84509833 GTAGGGAAGCAGGTGGGGGCAGG + Intronic
1141548608 16:84789080-84789102 ATGGAGCAACAGGGACGGGCTGG + Intergenic
1141991244 16:87611632-87611654 ATAGAGCAGCAGACAGAGGCGGG - Intronic
1142008014 16:87699395-87699417 GTAGAAAAGCAGGGCAGGGCCGG + Intronic
1142125620 16:88408913-88408935 ATAGGGAAGCGGGGAGGGAGGGG + Intergenic
1142254339 16:89006739-89006761 ATAGAGGGGGAGGGAGGGGAGGG - Intergenic
1142254364 16:89006800-89006822 ATAGAGGGGGAGGGAGGGGAGGG - Intergenic
1142446229 16:90140130-90140152 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1142461276 17:95333-95355 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1142809859 17:2390577-2390599 ATGGAGAGGGAGGGCGGGGCTGG - Intronic
1143259312 17:5586238-5586260 TTAGTGAAGCAGGGAGGGGCAGG - Intronic
1143340033 17:6203633-6203655 GGAGAGATGCTGGGAGGGGCTGG - Intergenic
1143376126 17:6468677-6468699 CTCAAGAAGCAAGGAGGGGCTGG - Intronic
1143716388 17:8773700-8773722 ACAAAGAAGCAGGGAGGGAACGG - Intergenic
1143724897 17:8838013-8838035 ATAGAGGAGTGGGGAGGGGAGGG + Intronic
1144833646 17:18145256-18145278 ATAGAGCAGGAGGTGGGGGCTGG + Intronic
1145196066 17:20895983-20896005 GGAGAAAAGCGGGGAGGGGCTGG - Exonic
1145904576 17:28509190-28509212 ACAGAGAGGGAGGGAGGGGCAGG - Intronic
1146552368 17:33792346-33792368 AAAGAGAAGCCGGGAGTGGAGGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146919737 17:36702681-36702703 ATGGAGCAGCAGGGTTGGGCAGG + Intergenic
1147055409 17:37830551-37830573 AAAGAGTAGCAGGCAGGGGCAGG + Intergenic
1147303204 17:39546089-39546111 ATAAAAAAGGAGGAAGGGGCCGG - Intronic
1147325908 17:39669533-39669555 AGAGAGAGGCAGGGAGATGCAGG + Intronic
1147587138 17:41659100-41659122 AGAGAGAACCAGGGGAGGGCAGG + Intergenic
1147597586 17:41726908-41726930 ATAGAGAAGCAATGAGTGGAGGG + Intronic
1147606410 17:41776144-41776166 ACAGAGGAGCAGGGCGGAGCAGG + Intronic
1147663003 17:42127481-42127503 AAAGAGAACCAGGGAGAGACAGG + Intronic
1147744114 17:42684627-42684649 AGAAAGAAGCAGAGGGGGGCCGG + Intronic
1147976977 17:44253420-44253442 ATGGAGAAGGAAGGAGGGGGTGG - Intronic
1148193509 17:45697061-45697083 AGAGAGAGGGAGGGAGGGGAGGG + Intergenic
1148473008 17:47907168-47907190 GTAGGGAAGGAGGGAGGGGACGG + Intronic
1148959454 17:51380968-51380990 ATAAATAAGCAGGGAGGGAGTGG + Intergenic
1149008936 17:51835003-51835025 CTAGAGTAGCAGGGAAGGGTTGG - Intronic
1149270836 17:54975722-54975744 TTAGAGAAGTAGGCAGGGTCTGG - Intronic
1149367507 17:55960587-55960609 AGACAGAAGCAGGAGGGGGCAGG + Intergenic
1149478274 17:56981879-56981901 ATGGAGAGGAAGGGAGGGTCAGG - Intronic
1149528971 17:57379871-57379893 AAAGAGAAGTTGGGAGGGGTGGG - Intronic
1149561720 17:57612168-57612190 GTGCAGAAGCAGCGAGGGGCAGG + Intronic
1149815409 17:59718490-59718512 AAAGAAAAGAAAGGAGGGGCCGG - Intronic
1149852224 17:60044790-60044812 ACAGAGAAGCCAGGAAGGGCTGG - Intronic
1150237568 17:63605326-63605348 ATAGAGATGGTGGGAGGGGCAGG + Intronic
1150287094 17:63960666-63960688 ATAGTGGAGCAGGAAAGGGCTGG + Intronic
1150947748 17:69765778-69765800 AGAGAGTAGAAGGGAGGGGAGGG - Intergenic
1151737818 17:75955958-75955980 AAAGAGAACAAGGGAGGGGTGGG + Intronic
1151751662 17:76042178-76042200 TTAGAAAAGCAAGCAGGGGCCGG - Intronic
1152008316 17:77695960-77695982 GCAGGGAAGCAGGGATGGGCAGG + Intergenic
1152640522 17:81447421-81447443 AGAGAGGAGCAGGGAGGAGGGGG + Exonic
1152717197 17:81905838-81905860 AGTGAGTAGCAGGGATGGGCTGG + Intronic
1152723323 17:81933377-81933399 CTAGAGAGGCAGGGAGAGGTTGG + Intronic
1152760263 17:82103829-82103851 AGGGAGGGGCAGGGAGGGGCAGG + Intronic
1153761670 18:8337802-8337824 ATAGATGGTCAGGGAGGGGCAGG + Intronic
1153883966 18:9446682-9446704 AAAGAGAGGGAGGGAGGTGCCGG - Intergenic
1153950494 18:10054126-10054148 ATGGAGGAGCAGGTAGGGGAGGG + Intergenic
1154534077 18:15379767-15379789 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1154991426 18:21601206-21601228 GTAAAGAAGGAGGGTGGGGCCGG + Intergenic
1155056137 18:22185412-22185434 ACTGAGAAGCTGGGAGTGGCTGG + Intronic
1156489063 18:37485691-37485713 ACCGAGCGGCAGGGAGGGGCGGG - Intronic
1156498096 18:37538996-37539018 TGAGAGCAGCAGGGTGGGGCAGG - Intronic
1156570718 18:38249897-38249919 ACAGAGAGGCAGGGAGGCCCAGG + Intergenic
1156779705 18:40836852-40836874 ATAGAGAAAGAGGGAGAGGGAGG + Intergenic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157594244 18:48854228-48854250 AGTGAGAAGCAGGGAGGGCAGGG + Intronic
1157744984 18:50127521-50127543 AAAGAGAACAATGGAGGGGCAGG + Intronic
1157816777 18:50735179-50735201 ATAGGGAAGAAGGGAGGGCCAGG - Intergenic
1159961476 18:74558816-74558838 CTAGAGGCACAGGGAGGGGCAGG + Intronic
1160121117 18:76131177-76131199 CTGGAGAGGCAGGCAGGGGCCGG - Intergenic
1160650977 19:227700-227722 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1160735748 19:661680-661702 GTAGAGACCCAGGAAGGGGCTGG - Intronic
1160950454 19:1664401-1664423 AGAGAGAGGGAGGGAGGGGAGGG - Intergenic
1161010379 19:1956979-1957001 AGAGAGAAGGAGGGAGGAGGAGG + Intronic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161995782 19:7710454-7710476 AAAAAGAATCAGGGAGTGGCTGG + Intergenic
1162582692 19:11540273-11540295 CTAGACAAGGATGGAGGGGCAGG + Intronic
1162705930 19:12554917-12554939 AGAGAGAAAGAGGGAGGGCCGGG + Intronic
1162874599 19:13611369-13611391 ATATAGAGCCAGGGAGGGGCTGG + Intronic
1162886189 19:13699145-13699167 AGAAAGAAGCAGGCAAGGGCCGG + Intergenic
1162891633 19:13737489-13737511 ATAGAAAAGCAGGTAGGGCTGGG + Intronic
1163032701 19:14554670-14554692 ACAGGGAAGGAGGGAGGAGCAGG - Intronic
1163047472 19:14654807-14654829 CTAGAGTGACAGGGAGGGGCAGG - Intronic
1163202694 19:15779984-15780006 GGAGAGAAGCAGGGAAGGGGTGG + Intergenic
1163430166 19:17262694-17262716 CTTGGGAAGCAGGAAGGGGCAGG - Exonic
1163492761 19:17626558-17626580 ATAGAGACCCAGGGACTGGCTGG - Intronic
1164757348 19:30700056-30700078 AGAGAGAAGGAGGGAGGCGGAGG - Intronic
1165032334 19:33007188-33007210 ATATAAAGGCATGGAGGGGCAGG + Intronic
1165124392 19:33583504-33583526 ATAGGGAAGCGGGGAGGGCGAGG - Intergenic
1165325381 19:35111619-35111641 ACAGGGAAGCAGGAAAGGGCAGG - Intergenic
1165395122 19:35559708-35559730 ATAGACAGGCAGGGAGGTGATGG + Intronic
1165425021 19:35740756-35740778 GTAGAGAAGCCGGGAGTGGGCGG - Intronic
1165598402 19:37031463-37031485 AAAGAGAAGCAAGGAGAGGATGG - Intronic
1165838564 19:38773543-38773565 AAATAAAAGCAGGGCGGGGCTGG + Intergenic
1165840995 19:38789154-38789176 AAATAAAAGCAGGGCGGGGCTGG - Intergenic
1165886572 19:39083504-39083526 AAAGAGAAGCAGGGAAGAACTGG - Intergenic
1165920935 19:39297614-39297636 ACAGAGAAGAAGGGTAGGGCTGG - Intronic
1166114000 19:40641580-40641602 ATGGAGAATCTGGGAGGCGCAGG + Intergenic
1166321623 19:42022461-42022483 AGAGAGAGGTAGGGAGGGGGAGG + Intronic
1166935746 19:46331343-46331365 ATAGGAAACCAGAGAGGGGCAGG + Intronic
1167035063 19:46990305-46990327 ACAGAGAGGCAGGCTGGGGCAGG - Intronic
1167299642 19:48671351-48671373 AGAGACAAGCAGGGCTGGGCAGG + Intronic
1167303611 19:48694594-48694616 AAAAAGAAACAGGGTGGGGCGGG - Intergenic
1167331184 19:48857363-48857385 ATAGAGAAGAAAGGAAGGGAGGG + Intronic
1167619221 19:50551864-50551886 AGAAAGAAGGAGGGAGGGGTGGG - Intronic
1168254994 19:55160298-55160320 ACAGACACGCAGGGAGGGCCAGG + Intronic
1168321317 19:55511723-55511745 CTGGAGAAGCTGGCAGGGGCTGG + Intronic
1168332832 19:55579733-55579755 ATGGAGAGGCAGAGAGGGTCAGG + Intronic
1168437152 19:56328104-56328126 AGAGAGAAGCATGGATGGACAGG + Intronic
1202688493 1_KI270712v1_random:69021-69043 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
925186479 2:1850126-1850148 AAAGGGAAGGAGGGAGGGGCAGG - Intronic
925196627 2:1931135-1931157 AGAGAGGAGAAGGGTGGGGCCGG + Intronic
925233022 2:2252648-2252670 AGACAGCAGCAGGGAGGGCCCGG + Intronic
925647782 2:6054618-6054640 GGAGAGATGGAGGGAGGGGCAGG + Intergenic
925751395 2:7093193-7093215 AGAGAGAATGAGGGAGGGGAAGG - Intergenic
925864275 2:8212527-8212549 ATAGAGAAAGAGGGAGAGGAAGG - Intergenic
925909321 2:8563001-8563023 ACAGGGAAACAGGGAGGGGTTGG + Intergenic
926018450 2:9474546-9474568 ATGGAGCAGCCGGGCGGGGCGGG - Exonic
926055418 2:9771394-9771416 CTAGAGGAGCTGGGAGGGGTGGG - Intergenic
926395285 2:12435015-12435037 AGAGGGAAGCAGGGAGAAGCAGG - Intergenic
926628508 2:15116072-15116094 AGAGAGTTGCAAGGAGGGGCTGG + Intergenic
926657001 2:15418814-15418836 CTAGAGTAGGAGGGACGGGCCGG + Intronic
926806767 2:16718366-16718388 ACAGAGCATCTGGGAGGGGCAGG - Intergenic
927506115 2:23615925-23615947 AAAGAGAAGCAGAGGGGGTCTGG - Intronic
927864164 2:26578122-26578144 AGATAAAAGCAGAGAGGGGCAGG - Intronic
928218018 2:29378707-29378729 AAAGAGAGGGAGGGAGGGGAGGG - Intronic
928278543 2:29923206-29923228 ATAGAGAAATAGGGAAAGGCTGG - Intergenic
928512445 2:32014033-32014055 ACAGAGAGGGAGGGAGGGGAGGG + Intronic
930021650 2:47005219-47005241 ACAGAGAGGAAGGGAGGGGGGGG + Intronic
930639490 2:53840537-53840559 AGAGAGAAGAGGGGAGGGGAGGG + Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
931469418 2:62523367-62523389 AGAGAGAAGCATAGAGGTGCAGG - Intergenic
931588635 2:63856463-63856485 AGACAGATGAAGGGAGGGGCGGG - Intronic
931994865 2:67830220-67830242 ACAGAGAAGCCAGGAGGGTCTGG - Intergenic
932325848 2:70861204-70861226 CTAGAGAAGCAGGAAAGTGCAGG + Intergenic
932468740 2:71940198-71940220 AGAGAGGAGGAGGCAGGGGCTGG - Intergenic
932495322 2:72143263-72143285 CTAGCGCAGCCGGGAGGGGCGGG + Intronic
932567976 2:72921242-72921264 GTAGGGAAGCAGGGAGGAGAGGG + Intronic
933723051 2:85410347-85410369 AGTGAGAAGCCGGGTGGGGCAGG - Exonic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
933957927 2:87386907-87386929 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
934242049 2:90278825-90278847 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
934271124 2:91537863-91537885 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
934527783 2:95062325-95062347 GTAGAGAGGGAGGGATGGGCAGG - Intergenic
934962707 2:98691095-98691117 ATAGAGAAAGAGGGTGGGGTGGG + Intronic
935317371 2:101848987-101849009 GAAGAGCAGCGGGGAGGGGCAGG - Intronic
935337548 2:102031153-102031175 AGGGAGAAGTACGGAGGGGCCGG + Intergenic
936255084 2:110904369-110904391 AAGGAGAAGCAGGGAAGGGTGGG + Intronic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
937048064 2:118863333-118863355 GGAGAGAAGCAAGGAGAGGCTGG + Intergenic
937107423 2:119330657-119330679 ATAGTGAAGGAGAGAGGGACGGG - Intronic
937190670 2:120094280-120094302 AAAGAGAATCCGGGAGGGCCTGG - Intronic
937339593 2:121082635-121082657 ATGGAGAGACAGGGAGAGGCAGG + Intergenic
937849085 2:126616987-126617009 TTAGAAAGGCATGGAGGGGCTGG + Intergenic
937905920 2:127052737-127052759 GCAGAGATGCTGGGAGGGGCAGG - Intronic
938199350 2:129360480-129360502 CTAGAGAAGCAGTGTGGGGAGGG - Intergenic
938258331 2:129877711-129877733 AGGGCGAAGCAGGGAGGGGAGGG + Intergenic
938532822 2:132206954-132206976 ACAGAGACGCAGGGAGGAGATGG - Intronic
938964424 2:136375681-136375703 AGAGAGAAGAGGGGAGAGGCAGG + Intergenic
939153871 2:138501936-138501958 ATAGGGAAGGAGGGCGGGTCGGG + Exonic
939579198 2:143928283-143928305 AGAGAGAAGGAGGGAGGGAGAGG + Intergenic
939779779 2:146431626-146431648 ATTGGGAAGAAGGGAGAGGCAGG + Intergenic
940274564 2:151925680-151925702 AAAGAGGAGCAGGGAGGGGGTGG + Intronic
941536752 2:166732199-166732221 ATAGTCAAGCAGGCAGGGGGTGG - Intergenic
942897128 2:181070591-181070613 ATAGAGAAGTAGGGAGTAGTTGG + Intronic
943231137 2:185253970-185253992 CTAGAGACGCAGGGAAGAGCAGG - Intergenic
943266490 2:185738841-185738863 CTAGAGAAGGAGAGCGGGGCGGG + Exonic
944631594 2:201631597-201631619 ATAAAGAATCAGGCAGGGGTGGG + Intronic
945114024 2:206393284-206393306 ATAGAGTAGTAAGGAAGGGCTGG + Intergenic
945811252 2:214553065-214553087 ATGGAGAAGAGGGGATGGGCTGG - Intronic
945911373 2:215653630-215653652 AGAGAGAAGCAGGGAGAAGGAGG + Intergenic
945965749 2:216184875-216184897 ATACAGAAGAAGGGAGGGTGAGG - Intronic
946039309 2:216770245-216770267 ATAGAGAGGCTGGGAGGTGATGG - Intergenic
946040730 2:216781123-216781145 ACAGAGAGGAAGGGAGGGGAAGG - Intergenic
946135376 2:217642368-217642390 AAAGAAAAGCAGGGAAGGGGAGG + Intronic
946416169 2:219540813-219540835 ATGTAGAAACAGGCAGGGGCTGG + Intronic
947375410 2:229490175-229490197 GGAAAGAAGCAGGGAGGGACAGG + Intronic
947805220 2:232961918-232961940 AGAGAGAAACAGGGAGGAGGGGG + Intronic
947838254 2:233190329-233190351 CTTGAGAAGCAGAGAAGGGCAGG - Intronic
947865516 2:233395611-233395633 AGAGAGAAGCGGGGAGGGGAGGG - Intronic
947981991 2:234418525-234418547 AGAAAGAAGCAGGCAGGGGTGGG - Intergenic
948091793 2:235301744-235301766 AGGGAGAAGGAGGGAGGGGGAGG - Intergenic
948148528 2:235726790-235726812 ATAGAAAGGCAGGGAGGGGGTGG + Intronic
948316900 2:237034818-237034840 ATTGAGAAAAGGGGAGGGGCTGG - Intergenic
948480696 2:238248341-238248363 AGAGAGCAGGAGAGAGGGGCTGG + Intronic
948569835 2:238910966-238910988 TCAGAGAAGCAGGGAGGTGGTGG - Intergenic
948577837 2:238965620-238965642 AGACAGGAGCAGGGAGGGGGAGG - Intergenic
948582822 2:238999506-238999528 AGACAGAAGCCAGGAGGGGCAGG - Intergenic
948672929 2:239580023-239580045 TTAGAGAACCAGGAAGGTGCAGG + Intronic
948680528 2:239631256-239631278 TTAAAGATGCAGCGAGGGGCAGG + Intergenic
948699969 2:239753358-239753380 ATGGAGCAGCAGGGAAGGGGTGG - Intergenic
948856083 2:240731293-240731315 AAACAGAGGCAGGGAGGGGGTGG + Intronic
1168769638 20:407415-407437 AAAGAGAAGCAAGGAGGCCCAGG + Intergenic
1168832359 20:853552-853574 ACAGAGAAGGTGGGTGGGGCTGG + Intronic
1168852510 20:986258-986280 AGTGAGCAGCAGGGAGGGACTGG - Intronic
1168953520 20:1818535-1818557 ATAGAGAGGGAGAGATGGGCTGG - Intergenic
1169535410 20:6533717-6533739 AAAAAGAAGCAGGCAGGGGTGGG - Intergenic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1169833514 20:9852293-9852315 ATAGAGAGATAGGGAGGGGCTGG + Intergenic
1170012559 20:11741924-11741946 ATAGAGAAACAGGGAGGCCGAGG - Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170728863 20:18955010-18955032 ATAGAGAAGCAGGGAAGGGCAGG - Intergenic
1170935372 20:20805029-20805051 GTAGAGAAGAAGGGAGAGGCTGG + Intergenic
1171223004 20:23418324-23418346 ATAGCTAAGAAGGCAGGGGCAGG + Intronic
1171249664 20:23638159-23638181 ACAGGGAAGCCTGGAGGGGCAGG - Intronic
1171400786 20:24871985-24872007 AAGGAGAAGAAGGGAGGGACAGG + Intergenic
1171464363 20:25317380-25317402 ACAGGGAAGCTGGGAGGGTCTGG - Intronic
1171508803 20:25662471-25662493 AGAGAGAAGTAGGGTGGGGTGGG + Intergenic
1172068861 20:32241614-32241636 GTAGAGATGGAGGGGGGGGCGGG - Intergenic
1172424375 20:34845309-34845331 GTAGAGCAGCGGGGTGGGGCGGG - Exonic
1172447991 20:35003047-35003069 AGAGAGCAGCAGGGAGGAACGGG + Exonic
1172573656 20:35989884-35989906 AGAGAGAAGAGGGGAGGGGAGGG + Intronic
1172949568 20:38714224-38714246 CTACTGAAGCAGGCAGGGGCTGG + Intergenic
1173023863 20:39289777-39289799 AAAGAGCAGAAGGGAGGGACAGG - Intergenic
1173303677 20:41827800-41827822 GGAGAGAAGGAGGGAGGGGGAGG + Intergenic
1173342131 20:42162111-42162133 AGAGAGCAGCTGGGAGGGTCAGG - Intronic
1173579829 20:44139191-44139213 ATGGAGAACCACAGAGGGGCAGG + Intronic
1173848585 20:46203259-46203281 GGAGGGAAGCAGGGAGGGGTGGG + Intronic
1174295827 20:49544349-49544371 CTACAGAAGCAGGCAGTGGCTGG - Exonic
1174297808 20:49561358-49561380 CTAGAGAAGCCGGGATGGGCTGG - Intronic
1174675879 20:52355024-52355046 ATAAAGAAGCAAGAATGGGCTGG - Intergenic
1174824118 20:53753858-53753880 AAAGTTAAGCAGGGTGGGGCGGG - Intergenic
1175100582 20:56576101-56576123 TGGGAGAGGCAGGGAGGGGCTGG - Intergenic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175370211 20:58483253-58483275 CTAGAGAAGCACAGAGCGGCTGG + Intronic
1175682366 20:60999039-60999061 CCAGAAAAGCAGGGAGGAGCAGG + Intergenic
1175748110 20:61475600-61475622 ACAGAGAGGGAGGGAGGAGCAGG - Intronic
1175779063 20:61670816-61670838 ATAGAAAGGAAGGAAGGGGCTGG + Intronic
1175886080 20:62291742-62291764 AGAGAGAAGCACGGAGGGAGCGG + Exonic
1175931102 20:62494114-62494136 ATGGAGACGCAGGCAGGGACTGG - Intergenic
1176031684 20:63015971-63015993 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031687 20:63015981-63016003 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031690 20:63015991-63016013 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031693 20:63016001-63016023 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031696 20:63016011-63016033 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176081290 20:63274462-63274484 ACAGTGAAGGAGGGAAGGGCTGG + Intronic
1176517568 21:7797490-7797512 ATAGGGAAGCAGGCAGCTGCAGG - Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178651596 21:34427502-34427524 ATAGGGAAGCAGGCAGCTGCAGG - Intergenic
1179494541 21:41763506-41763528 AGTGAGAAGCAGGGAGGTGGGGG + Intronic
1179630000 21:42671458-42671480 ATAGAGAAGCAGTGATTGTCTGG + Intronic
1179654434 21:42836722-42836744 ATGGAGTAGCAGGGATGGGGCGG - Intergenic
1179979076 21:44887144-44887166 ACAGAGAAGAAGGCAGGGCCAGG + Intronic
1180510820 22:16087280-16087302 ACAGAGACGCAGGGAGGAGATGG + Intergenic
1180552995 22:16555993-16556015 ATAGAGCAGGAAGCAGGGGCGGG + Intergenic
1180636143 22:17264526-17264548 AGAGAGAAGGAGGGAGGGCGGGG - Intergenic
1180636158 22:17264588-17264610 ACAGAGAAGGAGGGAGGGAGGGG - Intergenic
1180638059 22:17276416-17276438 AAAGAGAAGAGGGGAGGGGAGGG + Intergenic
1180669705 22:17543422-17543444 AAAGAGAAGCTGGGAAGGCCGGG - Intronic
1181351096 22:22258446-22258468 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1181760068 22:25052122-25052144 AGAGAGGAGCTGGCAGGGGCTGG - Intronic
1181901577 22:26160487-26160509 ATAGGGCAGCAGGGAGGAGCTGG - Intergenic
1182026972 22:27127752-27127774 CTAGAGAAGCTGGTAGAGGCAGG + Intergenic
1182269114 22:29142349-29142371 AGAGAGATGCAGAGAGGGCCGGG - Intronic
1182800530 22:33028587-33028609 ATTAAGCAGCAAGGAGGGGCTGG + Intronic
1182841764 22:33396498-33396520 ATAGGGAAGGAGGGAGGGGTGGG + Intronic
1182841973 22:33398410-33398432 ATAGAGAAGCAGAGAGTTGGAGG - Intronic
1182886386 22:33777623-33777645 ACAGAGAGGGAGGGAGGGGAAGG + Intronic
1183061752 22:35340449-35340471 CTAGGAAAGCAGGGAGGGCCGGG + Intronic
1183153088 22:36053514-36053536 AGGGAGAAGCAGGGAAGGGAAGG - Intergenic
1183189774 22:36314382-36314404 CTTGAGAAGGAGGGTGGGGCAGG + Intronic
1183232440 22:36591381-36591403 AGAGGGAAGAAGGGAGGGGCTGG + Intronic
1183352673 22:37342815-37342837 AAAGGGAAGCGGGGAGGGGAGGG + Intergenic
1183734114 22:39634469-39634491 TTAGAGAAACAGGGAGGGGGAGG - Intronic
1183752926 22:39732333-39732355 TGACAGAAGCAGGCAGGGGCAGG - Intergenic
1183863293 22:40684711-40684733 AGTGAGGAGCAGGCAGGGGCTGG - Intergenic
1183896827 22:40976072-40976094 AAAGAGAAGAAGTGAGGGCCGGG - Intergenic
1184039829 22:41936213-41936235 GGAGAGAAGCAGAGTGGGGCTGG + Intergenic
1184498875 22:44860045-44860067 GTACAGGAGCAGGCAGGGGCAGG - Intronic
1184660106 22:45961712-45961734 AAACTGAGGCAGGGAGGGGCAGG - Intronic
1184692494 22:46123635-46123657 AGACAGCAGCAGGGAGGGCCGGG + Intergenic
1184920337 22:47601102-47601124 ACACAGAGGCTGGGAGGGGCAGG - Intergenic
1184958830 22:47914006-47914028 CAAGAGGAACAGGGAGGGGCAGG - Intergenic
1185036953 22:48484480-48484502 AAGGAGAAGGAGGGAGGGGAGGG - Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
1185414311 22:50701354-50701376 AAAGGGAAGGAGGGAGGGGAGGG - Intergenic
949415085 3:3805414-3805436 ACAGAGAATCAGGAAGGCGCAGG + Intronic
949895103 3:8762695-8762717 CCACAGAAACAGGGAGGGGCTGG + Intronic
950098785 3:10345023-10345045 AGAGGGAGGCAGGGAGGGGCAGG - Intronic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950704888 3:14773485-14773507 ATAAACAAGGAGGGAGGGGGAGG + Intergenic
950841987 3:15976623-15976645 AGAGAGCAGCAGGGGAGGGCAGG - Intergenic
950850262 3:16055433-16055455 ATAGAAAGGCAGGGAAGGGAGGG + Intergenic
951646213 3:24894269-24894291 AGAGAGAGGCAGGGCGGGGGCGG - Intergenic
951891655 3:27573268-27573290 AGAGAGAAGAAAGGAGGTGCTGG - Intergenic
952423225 3:33149503-33149525 AGAGGGAAGTAGGGGGGGGCGGG + Intergenic
952647619 3:35680771-35680793 AAAGAGAAGGAGGGAGGAGGAGG - Intronic
952826676 3:37530320-37530342 CTAGAAAAGCAGGGAGGGCTAGG + Intronic
952830204 3:37558451-37558473 ATAGAGAAGCAAGGGGTGGGAGG - Intronic
953374040 3:42413634-42413656 AGAGAGAACCAAAGAGGGGCGGG - Intergenic
953720071 3:45347526-45347548 ACTGAGAAGCAGGGAGCAGCAGG + Intergenic
953786622 3:45916153-45916175 GCAGAGTGGCAGGGAGGGGCGGG + Intergenic
953896641 3:46808300-46808322 ATAGAGCAGCAAGGAGAAGCAGG + Intronic
953980403 3:47410511-47410533 ACAGGGAAGCAGGGCGGGGGAGG - Exonic
954424397 3:50435765-50435787 AAAGAGAAGCCGGGAGGGATGGG - Intronic
954996011 3:54882357-54882379 AGAGAGAGGAAGGGAGGGACAGG - Intronic
955301056 3:57780139-57780161 AAAAAAAAGAAGGGAGGGGCAGG - Intronic
955403926 3:58613491-58613513 CCAGAGCAGCAGGCAGGGGCTGG - Intronic
956111100 3:65870579-65870601 GTAGAGAAGGAGGGAGGGAGAGG + Intronic
956542690 3:70360130-70360152 TTAGAGAAGAAGGGAGGGAGGGG + Intergenic
956761763 3:72449958-72449980 ACAGAGGAGCAGGGACTGGCTGG - Intergenic
956780111 3:72596868-72596890 GTGGAAAAGCAGGGAGGGGGTGG + Intergenic
956838771 3:73117694-73117716 AGAGGGAAGGAGGGAGGGGAGGG - Intergenic
956887591 3:73575956-73575978 AAAGAGAGACAGAGAGGGGCAGG + Intronic
956889693 3:73600049-73600071 ATAAAAAAACAGGGAGGAGCTGG + Intronic
957048958 3:75396869-75396891 ATGGAGAATCAGGGATGGTCTGG + Intergenic
957071144 3:75568781-75568803 ACAGACAAGCGGGTAGGGGCTGG + Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957956546 3:87195883-87195905 ACAGAGCAGCAGGGAGGCCCTGG - Intergenic
958193759 3:90216650-90216672 AAAGAGAAGCAAGCAGGGTCAGG - Intergenic
958752193 3:98204560-98204582 AGAGAGAAGCAGGAAGGACCAGG - Intergenic
958936865 3:100264294-100264316 AAAGAGAGGGAGGGAGGGGGAGG - Intronic
959925420 3:111915845-111915867 ATAGGGAAGAAAGTAGGGGCAGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
961054202 3:123774062-123774084 ATGGAAAAGCAAGGAGAGGCTGG + Intronic
961070278 3:123917705-123917727 TTAGAGAAGCCTGGAGAGGCAGG + Intronic
961282964 3:125777936-125777958 GCAGACAAGCAGGTAGGGGCTGG - Intergenic
961482562 3:127193410-127193432 CAAGAGAAGCAGGGAAGGGGCGG - Intronic
962072143 3:132044561-132044583 AAAGAGAGGAAGGGAGGGGAAGG + Intronic
962508917 3:136078758-136078780 ATAGATAAGCCTGGAGGGGTGGG + Intronic
962545465 3:136429715-136429737 ATGGAGAAGGAAGGAGAGGCAGG - Intronic
962930868 3:140034665-140034687 AGTGAGAAGCAGGGAGGGCGGGG + Intronic
962957187 3:140276910-140276932 GCAGAGAAGCAGGGAGAGGCAGG + Intronic
963057712 3:141200973-141200995 AGAGAGAAGAAGGCAGGAGCAGG + Intergenic
963815479 3:149825939-149825961 AAAGAGGGGTAGGGAGGGGCAGG - Intronic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
965406446 3:168275096-168275118 ATAGAGCAGCAGACAGGAGCTGG + Intergenic
966554230 3:181241106-181241128 ATAGAGAAGCTGGAAGGGGTGGG + Intergenic
966768915 3:183486674-183486696 ATACACCAGCAGGGAGGAGCTGG + Intergenic
966916581 3:184587607-184587629 AATGAGAAACAGAGAGGGGCAGG - Intronic
967281829 3:187830464-187830486 GTAGAGCAGCATGGAGGGGTGGG - Intergenic
967553847 3:190831565-190831587 ATCCAGATGCAGGGAGGGGCCGG - Intergenic
967921387 3:194617005-194617027 AGAGAAAAGAAGGGTGGGGCAGG + Intronic
968286676 3:197513049-197513071 ACAGAGCAGCAGGCAGGGGCAGG + Intronic
968366853 3:198192287-198192309 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
968566573 4:1316613-1316635 AGACAGAAGCAGGGAGGAGGTGG - Intronic
968572479 4:1349320-1349342 ACACAGAAACAGGCAGGGGCTGG + Intronic
968933553 4:3597374-3597396 CTGGAGCAGAAGGGAGGGGCGGG + Intergenic
968984994 4:3870165-3870187 ATGGAGCAGAAGGGACGGGCCGG + Intergenic
969014753 4:4096486-4096508 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
969211051 4:5687521-5687543 GCAGGGAAGCAGGAAGGGGCAGG + Intronic
969284783 4:6196348-6196370 GTGGATCAGCAGGGAGGGGCAGG - Intronic
969308843 4:6340522-6340544 ATGGAGAGGGAGGGAGGGTCGGG - Intronic
969498641 4:7540165-7540187 AGGGAGGGGCAGGGAGGGGCAGG - Intronic
969498646 4:7540175-7540197 AGGGAGGGGCAGGGAGGGGCAGG - Intronic
969498651 4:7540185-7540207 AGGGAGGGGCAGGGAGGGGCAGG - Intronic
970563688 4:17309753-17309775 ACAGAGAAACAGGCAAGGGCAGG + Intergenic
971001950 4:22333144-22333166 AAGGAGAAGCAGGCAGGAGCTGG - Intergenic
971311570 4:25529923-25529945 GGAGAGAAGAAGGGAGGGGAAGG + Intergenic
972418182 4:38862973-38862995 ATAGAGGAGCAAGGAGGGGAAGG - Intergenic
972505600 4:39717523-39717545 CTAGAAAAGCTGGGAGAGGCTGG - Intronic
972522879 4:39878117-39878139 ATAGAGAAGCAGGGAGAAAGGGG + Intronic
972698618 4:41472349-41472371 AGAGGGAGGAAGGGAGGGGCAGG - Intronic
973270201 4:48254800-48254822 ATAGGGCAGGATGGAGGGGCGGG + Intronic
974055156 4:56976929-56976951 GTAGAGCACCAGGGAGGGGCCGG + Exonic
974889284 4:67860123-67860145 ATAAAGAAGCAGGGGTGGGGTGG + Intronic
975079309 4:70256298-70256320 ACAGAGGAGCTGGGAGGGCCAGG - Intergenic
975815883 4:78216547-78216569 ATAGAGAAGCAGAGGGGAACAGG + Intronic
975985879 4:80201565-80201587 GGAGAGACGCAGGGAGCGGCAGG + Intronic
976226960 4:82801626-82801648 ACACAGAAGCAGGGAGGAGGGGG + Intergenic
976806669 4:89054940-89054962 AGAGAGAAGTAGGGAGCTGCAGG - Intronic
977470270 4:97434786-97434808 AGAGAGAAGGAGAGAGGGCCAGG + Intronic
978674529 4:111295112-111295134 ACAGAGAAGCAGGGAAAGGTAGG + Intergenic
978955477 4:114607510-114607532 ATAGAGAAGAGGAGAGGTGCTGG - Intronic
979116323 4:116829316-116829338 GTAGAGCAGCTGGGATGGGCTGG - Intergenic
979255267 4:118601896-118601918 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
979333069 4:119438616-119438638 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
979906560 4:126300737-126300759 ACAGAGTAGGAGGGAGGTGCTGG + Intergenic
980453297 4:133005558-133005580 ATAAGGAAGCAGGGAGGGGTGGG + Intergenic
981043279 4:140242869-140242891 ATGGGGAAGAAGGGAAGGGCAGG + Intergenic
981375988 4:144016434-144016456 AGAGAGAAGCAGAGAGGGAGAGG - Intronic
981386514 4:144137793-144137815 AGAGAGAAGCAGAGAGGGAGAGG - Intronic
981437428 4:144741968-144741990 AGAGAGAAGGAGGGAGGGAGAGG - Exonic
981624750 4:146742715-146742737 AGAGAGCAGAAGGGAGGGGAGGG - Intronic
981912224 4:149995225-149995247 AAAGGGAAGGAGGGAGGGGGAGG + Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
982612114 4:157588448-157588470 AGAGAGAGGCAGGGAGGTGCCGG + Intergenic
983090220 4:163494161-163494183 AAAGAGAAGAGGGGCGGGGCGGG + Intergenic
984325609 4:178246765-178246787 AGAGAGAGGCAGGGTGGGGGGGG + Intergenic
984622252 4:181967097-181967119 GTAGACAAGCAGGGAGTGGAAGG - Intergenic
985648746 5:1097702-1097724 ACAGAAAAGCAGGGTGTGGCTGG + Intronic
985786882 5:1900610-1900632 GTGGAGAGGCAGGGAGGGCCAGG - Intergenic
985797655 5:1975178-1975200 AGAGAGAATCAGGAAGGGGAAGG + Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
985945742 5:3181579-3181601 AGAGAGAACCAGGGAGAGGGAGG - Intergenic
985963518 5:3321977-3321999 ACAGAGTAGCAGGGAGAGCCAGG + Intergenic
986253325 5:6081269-6081291 ATGGAGAGGCTGGGAGGCGCAGG - Intergenic
986879095 5:12147854-12147876 ATGGAGGAGGAGGGAGGGGGAGG - Intergenic
987116725 5:14731658-14731680 TTAGAGAATCAGGGAGAGGCTGG + Intronic
987339051 5:16923050-16923072 AAAGAGAAGAGGGGAGGGGAGGG + Intronic
988264293 5:28928756-28928778 ATGGAGAATCAGGGATGGTCTGG + Intergenic
989116701 5:37961622-37961644 AGAGTGAGGCAGGGAGGGGTGGG + Intergenic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990335238 5:54765839-54765861 ATGAAGACACAGGGAGGGGCTGG + Intergenic
990524100 5:56607941-56607963 TTTGAGATGCAGGGAGGAGCGGG + Intergenic
990799021 5:59578651-59578673 AAAGAGGACCAGGGAGGAGCAGG - Intronic
991024086 5:62011177-62011199 ACAGGGAAGCAGGCAGGAGCAGG + Intergenic
991502305 5:67289322-67289344 GTAGGGAAGGAGAGAGGGGCAGG + Intergenic
991507116 5:67337031-67337053 AGATAGAAGCTGAGAGGGGCTGG - Intergenic
991963316 5:72066974-72066996 ACAGATAAGCAGAGAAGGGCTGG + Intergenic
992900729 5:81292450-81292472 AGAGAGGAGCAGTTAGGGGCTGG - Intergenic
993050259 5:82918394-82918416 ATCAAGAAGCGGGGTGGGGCAGG - Intergenic
993053474 5:82952711-82952733 TTAGAGAAACAGGCAGGGGCTGG - Intergenic
993129479 5:83877064-83877086 AAAGAGAAGCAGGGACAGGTAGG + Intergenic
993842881 5:92901890-92901912 GAAGAGAAGCAGGGATGGCCAGG + Intergenic
994500055 5:100564044-100564066 ATATAGGAGCAAGGAGGAGCAGG - Intronic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995580269 5:113592157-113592179 GCAGATAAGCAGGGATGGGCAGG + Exonic
995747950 5:115423651-115423673 ATACCGCAGCAGGGAGGGGCAGG + Intergenic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
997385978 5:133473070-133473092 CTAAAGAAACAGGGAGGGGAAGG - Intronic
997539339 5:134648793-134648815 AGAGAGAAGGAGGGAGGCCCTGG - Exonic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
997602331 5:135149247-135149269 AGAGAGAAGAAGGGGGAGGCTGG + Intronic
997629091 5:135353156-135353178 AAAGGGAAGCAGGGAGTTGCTGG + Intronic
997822644 5:137079725-137079747 AGAGTGAAGCAGGGACGGGGAGG - Intronic
998182307 5:139954080-139954102 AAAGAGACCCAGGGAGGGGTGGG + Intronic
998522805 5:142816092-142816114 CTACAGAAGCACAGAGGGGCTGG - Intronic
998600793 5:143582695-143582717 AGAGAGATGCAGGGAGGGAGAGG + Intergenic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999378065 5:151100853-151100875 ATAGAGACTCAGGGAGGGAAAGG + Intronic
999382191 5:151129178-151129200 CTACAGAAGGAGGCAGGGGCTGG - Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999536570 5:152523810-152523832 ATAGAGAAGCAGGCAGATACTGG + Intergenic
999707378 5:154285858-154285880 ACAGAGAAGCAGGGAAAGTCTGG - Intronic
999719830 5:154391447-154391469 ACAGAGAAGGAGGGAGGGAAAGG - Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000328220 5:160188134-160188156 GGAGAAAAGCAGGCAGGGGCCGG + Intronic
1000367734 5:160506561-160506583 AGAGAGAATCAGGTAGGGGAGGG + Intergenic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001621816 5:173093113-173093135 ATTTAGGAGCAGGGAGGGGAAGG + Intronic
1002304565 5:178275512-178275534 TTAGGGAAGAAGGGAGGGGGAGG + Intronic
1002612927 5:180433213-180433235 AGAGTGAAGCAGGAAGTGGCAGG - Intergenic
1002850905 6:995635-995657 AGAGGGAAGGAGGCAGGGGCTGG - Intergenic
1002984639 6:2177007-2177029 AGAGAGAAACAGGAAAGGGCAGG + Intronic
1003286863 6:4742062-4742084 TTAGAAAAGCAGGGAAAGGCTGG + Intronic
1003323376 6:5072812-5072834 ATAGGTGATCAGGGAGGGGCAGG + Intergenic
1005195639 6:23280681-23280703 TTAGAGAAGTAGGGAGGGATGGG + Intergenic
1005490335 6:26341946-26341968 AGAGAGAAGGAGGGAGGGAGAGG + Intergenic
1005624610 6:27651624-27651646 ACAGAGAAGGAGGGAGGGAGAGG + Intergenic
1005835573 6:29706216-29706238 AAAGAGAAACAGAGACGGGCAGG - Intergenic
1006020131 6:31112831-31112853 ATAGAGAAGCAGGGCTGGGGAGG - Intergenic
1006083409 6:31580391-31580413 ATTCAGAGGCAGGGAGGGGGTGG + Intergenic
1006175443 6:32118612-32118634 ATAATGGAGCAGGAAGGGGCTGG + Intronic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1006937467 6:37728405-37728427 ATAGAGAAGTTGGGAGGCTCTGG - Intergenic
1006937550 6:37728957-37728979 CAAGAGAAGCAGGGGAGGGCAGG + Intergenic
1006972872 6:38065022-38065044 AAAGAAAAGCAGGGAGGGCTGGG + Intronic
1007193253 6:40037896-40037918 AAAGAATAGCAGGGAAGGGCAGG + Intergenic
1007236296 6:40393128-40393150 AGAGGGGAGGAGGGAGGGGCAGG + Intronic
1007375017 6:41450715-41450737 ATAGAGCCGCAGGAAGGGCCTGG + Intergenic
1007414599 6:41684326-41684348 ATCGCGGGGCAGGGAGGGGCAGG - Exonic
1007415245 6:41687820-41687842 AAAGAGAAGGAGAGAGGAGCTGG + Intronic
1007549633 6:42719250-42719272 CCAGAGAAGCAGGGAGGCGGGGG - Intronic
1007840547 6:44712530-44712552 AGGGAGGAGCAGGGAGGAGCAGG + Intergenic
1008049804 6:46888747-46888769 AGAGAATAGCAGGGAGGGTCTGG + Intronic
1008091524 6:47298493-47298515 ATACAGAAACAGGCAGGTGCTGG - Intronic
1009295634 6:61942964-61942986 AGAGAGAGGGAGGGAGGGGGAGG + Intronic
1009514377 6:64596068-64596090 AGAGAGAGCCAGGGAGGGGATGG + Intronic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1010451146 6:76004683-76004705 AGAAAGTAGCAGGGAGGGGAGGG - Intronic
1010991205 6:82482310-82482332 AGAGAGAAGGAGGAAGGGGCTGG - Intergenic
1011195698 6:84777155-84777177 ATAGACAAGCAGGGAGCGTGAGG - Intergenic
1011441221 6:87389587-87389609 ATACAGAAACAGGCAGGGGCTGG + Intronic
1011647273 6:89471821-89471843 ATAGAGAAGGAGGGAGGCCGAGG + Intronic
1012270044 6:97197905-97197927 ATAGAGATGCAGGGTGGGGGAGG - Intronic
1012624757 6:101392656-101392678 ACAGTGAAGCAGGGAGAGCCTGG + Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1012961904 6:105630973-105630995 ATAAAGAAGGAGGGAGGGAGTGG + Intergenic
1013270552 6:108542000-108542022 AGAGAGAAGGAGGGAGAGGGAGG - Intergenic
1014038840 6:116800185-116800207 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1014397349 6:120942019-120942041 ATAGAGAAGCTGGGAGAGACTGG + Intergenic
1014397589 6:120945144-120945166 AGACAGAAGGAGTGAGGGGCAGG + Intergenic
1014439779 6:121460883-121460905 ATAAAAAAGAAGGGAGGGCCGGG - Intergenic
1015163964 6:130182618-130182640 AGAAAGAAGGAGGGAGGGGAGGG + Intronic
1015245192 6:131066740-131066762 ACAGAGAAACAGGGATGGACTGG + Intergenic
1015514893 6:134073835-134073857 CTGGAAAATCAGGGAGGGGCAGG + Intergenic
1016725346 6:147358833-147358855 AAAGAGAAAGAGGGAGGGGTTGG + Intronic
1017007962 6:150041457-150041479 ATAGGGAAGGAGGGGTGGGCAGG + Intergenic
1017418534 6:154247548-154247570 AGAGAGAAGGAGGGAGGAGGTGG + Intronic
1017509385 6:155100267-155100289 ATAGAGCAGGAGGCAGGAGCAGG + Intronic
1018136116 6:160779834-160779856 ATAGGGAAGCGGGGTGGGGGGGG - Intergenic
1018607537 6:165613913-165613935 ATGGAGAAGGAAGGAAGGGCTGG - Intronic
1018670305 6:166171529-166171551 CTAGAGCAGCAGGGAGGGGCCGG - Intergenic
1019128959 6:169859755-169859777 ACAGAGGAGCAGGGAGAGACAGG - Intergenic
1019131890 6:169883032-169883054 AGAGAGAACCAGGGTGGGGAAGG - Intergenic
1019792363 7:3024342-3024364 ATTCAGAAGTGGGGAGGGGCAGG + Intronic
1021797056 7:24266364-24266386 ACAAAGAAGAAGGCAGGGGCTGG + Intergenic
1022025457 7:26444101-26444123 ATAAAGAAGCAATAAGGGGCAGG - Intergenic
1022450742 7:30512457-30512479 GTAGAGAGACAGGCAGGGGCTGG + Intronic
1022590210 7:31654341-31654363 ATGGAGATGGAGGGAGGGGAAGG + Intronic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023146149 7:37153011-37153033 TCAGAGAAGGAGTGAGGGGCAGG + Intronic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023167686 7:37358974-37358996 ATAGACAAACAGGGAGAAGCTGG + Intronic
1023370183 7:39505490-39505512 AAAGAGAGGGAGGGAGGGACAGG - Intergenic
1023397366 7:39763749-39763771 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1023870149 7:44258935-44258957 ACAGAGAAGCCATGAGGGGCTGG + Intronic
1025135307 7:56406719-56406741 AGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1026024349 7:66732907-66732929 TTAGAGAAGCAGGGCGAGCCTGG - Intronic
1026615385 7:71897996-71898018 AGAGAGAGGGAGGGAGGGGGGGG + Intronic
1026718831 7:72813470-72813492 TTAGAGAAGCAGTTAGAGGCTGG - Intronic
1026848950 7:73712949-73712971 ATATAGAAAGAGGGAGGGGATGG - Intronic
1027053371 7:75033311-75033333 ACAGAGAAGCAGGGAGGGACGGG + Intronic
1028535470 7:91886869-91886891 AGAGGGAGACAGGGAGGGGCAGG - Intergenic
1029073425 7:97918115-97918137 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1029402867 7:100356491-100356513 AGACAGAAGCAGGCAGGGACAGG - Intronic
1029405516 7:100372381-100372403 AGACAGAAGCAGGCAGGGACGGG - Intronic
1029443061 7:100598592-100598614 AGAGAGAGGCAGGAAGCGGCAGG + Intronic
1029643013 7:101832892-101832914 ATGGCCATGCAGGGAGGGGCCGG + Intronic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1030070652 7:105694774-105694796 AGAGGGAAGCAAGGAGGGCCGGG - Intronic
1030165870 7:106554311-106554333 AAAGAGAAGCTGGTAGGGGGAGG + Intergenic
1030172669 7:106619724-106619746 CTTGAGCAGCTGGGAGGGGCAGG - Intergenic
1030189313 7:106794709-106794731 ATAGAGTTGGAGGGTGGGGCAGG + Intergenic
1030926494 7:115461821-115461843 AGAGAGAAGCAGAGAGAGTCAGG - Intergenic
1031586207 7:123534680-123534702 AGAGGGCAGCGGGGAGGGGCCGG + Intronic
1031965723 7:128026973-128026995 ATAAAAAAGCGGGGAGGGGAGGG - Intronic
1032189760 7:129757878-129757900 ATGCAGAAGCATGGAGGTGCAGG - Intergenic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032520332 7:132539026-132539048 ACAGGGAAACAGGCAGGGGCTGG - Intronic
1032657482 7:133947295-133947317 AAAGAGAAGCCTGAAGGGGCAGG - Intronic
1032902713 7:136328700-136328722 AGAGAGAAGAGGGAAGGGGCAGG + Intergenic
1034959347 7:155355358-155355380 ATGCAGAAGATGGGAGGGGCTGG + Intergenic
1035029759 7:155849464-155849486 AAAGACAAGCAGGGAGGAGATGG + Intergenic
1035117816 7:156539676-156539698 AGAGAGAAGCAGGGGGAGGGAGG - Intergenic
1035894903 8:3388851-3388873 AGAGAGAGGGAGGGAGGAGCAGG - Intronic
1035971883 8:4258325-4258347 AAAGAGAGGGAGGGAGGGGAGGG + Intronic
1036164782 8:6422561-6422583 ATAGAGAATGAGTCAGGGGCTGG - Intronic
1036192271 8:6680865-6680887 AGAGAGAAGGAGGGAGAGGAAGG - Intergenic
1036361008 8:8076928-8076950 GCAGACAAGCAGGTAGGGGCTGG - Intergenic
1036588258 8:10144999-10145021 AAGGAAAAGCAGGGAGAGGCGGG - Intronic
1036641102 8:10584436-10584458 CTAGAGAAGAAGGGACGGCCGGG - Intergenic
1036743795 8:11389968-11389990 AGAGAGAAGCAGGGATGGGTGGG + Intergenic
1036889956 8:12590073-12590095 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1036897569 8:12648234-12648256 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1037409478 8:18581004-18581026 AGAGAGAAGCAGAGACTGGCAGG + Intronic
1037804289 8:22050521-22050543 AGAGGGAGGGAGGGAGGGGCCGG - Intronic
1037951027 8:23018906-23018928 AGAGAGGAGGAGGGCGGGGCTGG + Intronic
1038050676 8:23807582-23807604 AAAGAGAAGCAGGAAGGGTGAGG + Intergenic
1038455184 8:27668173-27668195 AAAGAGGAGCTGGAAGGGGCTGG + Intronic
1038720475 8:30030920-30030942 AGAGAGAGGGAGGGAGGGGAGGG + Intergenic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1038898324 8:31812667-31812689 AGAGAGGAGCAGCGAGGGGAGGG - Intronic
1039459193 8:37729172-37729194 AAAGAAAAGAAGGAAGGGGCAGG + Intergenic
1039472875 8:37825049-37825071 ACAGAGATACAGGGAGGGGGTGG + Intronic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039776067 8:40738047-40738069 AAAGAAAAGCAGGAAGGGACGGG + Intronic
1040075240 8:43222775-43222797 AATGAGAAGCAGTTAGGGGCTGG + Intergenic
1040384495 8:46905095-46905117 ACAGAGAACCAGCGAGGGGGAGG - Intergenic
1041059420 8:54021979-54022001 AGGGAGAAGGAGGGAGGGGGCGG + Intronic
1041249643 8:55921724-55921746 TGGGAGAGGCAGGGAGGGGCAGG + Intronic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1043059523 8:75482358-75482380 ATGGAGCAGAAGGGAGGGGAGGG - Intronic
1043267057 8:78279564-78279586 AGAAATAAGCAGGGAGGGACTGG + Intergenic
1043927107 8:86049622-86049644 AGAGAGAAGAGGGGAGGGGAAGG + Intronic
1043929084 8:86069697-86069719 AAAGAGCAGCTGCGAGGGGCGGG + Exonic
1043987330 8:86708969-86708991 ATAGAGAAATAGGGTGTGGCTGG + Intronic
1044211991 8:89561323-89561345 ATAGAGGAACTGGGAGGGGGGGG - Intergenic
1044299996 8:90572785-90572807 ATAGAGAAGGAAGGAAGGGAGGG + Intergenic
1044386268 8:91592203-91592225 ACAGTGGAGCAGGGAGGAGCTGG + Intergenic
1044514226 8:93120131-93120153 GAAGAGAGGCAGGCAGGGGCTGG - Intergenic
1045026038 8:98087617-98087639 AAAGAAAGGCAGGGAGGGGAGGG - Intronic
1045168088 8:99629665-99629687 ATAGAGGAGCAGTGAGGTGTGGG + Intronic
1045333850 8:101180653-101180675 AGAGAGAAAGAAGGAGGGGCTGG - Intronic
1045356871 8:101397098-101397120 AAAGAGGACCAGGAAGGGGCAGG + Intergenic
1045411070 8:101919958-101919980 ATAGAAAAGCAGTTTGGGGCTGG + Intronic
1045421097 8:102015937-102015959 AAAAAGAAGAAGGGTGGGGCTGG + Intronic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1045737949 8:105318578-105318600 GAAGAGAAGGAGGGAGGGACGGG - Intronic
1045980464 8:108180815-108180837 ATAGCCAAGCTTGGAGGGGCAGG + Intergenic
1046048304 8:108988782-108988804 AGAGAGAGGCAGGGAGGGAAAGG + Intergenic
1046908195 8:119597022-119597044 ATTCAGATGCAGGAAGGGGCGGG + Intronic
1047188979 8:122660986-122661008 ATAGAGAAGCAAGGAGTTGGAGG - Intergenic
1047231294 8:123000344-123000366 GAAGGGAAGGAGGGAGGGGCCGG + Intergenic
1047489580 8:125363555-125363577 AGAGAGAGGGAGGGAGGGGGAGG + Intronic
1047542692 8:125785570-125785592 ACACTGAAACAGGGAGGGGCAGG - Intergenic
1047629539 8:126692105-126692127 AGAGAGAAGAAGGGAAGGGAAGG - Intergenic
1047658977 8:127011724-127011746 ATAGAGAAGGGGGGTGGGGGTGG + Intergenic
1047681121 8:127255296-127255318 AGAGAGAGACAGAGAGGGGCAGG + Intergenic
1048177397 8:132164998-132165020 AGAGAGAAGCAGAGATGGCCTGG - Intronic
1048324480 8:133428576-133428598 AGAGAGAAGCATAGAGTGGCTGG - Intergenic
1048469640 8:134695522-134695544 TTAGAGATGCAGGCAGGGCCTGG - Intronic
1048469730 8:134695846-134695868 TTAGAGAGGCAGGCAGGGCCTGG - Intronic
1048469785 8:134696048-134696070 TTAGAGACGCAGGCAGGGCCTGG - Intronic
1048682026 8:136853719-136853741 AAAAAAAAGAAGGGAGGGGCAGG + Intergenic
1048889347 8:138933942-138933964 ATGGAAAAGCAGGGATGGGGAGG - Intergenic
1049206186 8:141364748-141364770 ATGGGGAGGCAGGGAGGGGCTGG - Intronic
1049356706 8:142192735-142192757 AGGGAGGAGCAGGGAGGGGGAGG + Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049627552 8:143632572-143632594 ATGGTGACGCAGGGTGGGGCAGG - Intergenic
1049761749 8:144334775-144334797 ATGGAGGAGCAGGGAGGGCAGGG - Intronic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1050715299 9:8517803-8517825 ATAGGGCAGGAGGGAAGGGCTGG - Intronic
1051103649 9:13551320-13551342 ATAGGGAAGAAGGGAAGTGCCGG - Intergenic
1051120333 9:13745522-13745544 AGAGAGAACCAGGGAGAGTCCGG + Intergenic
1051823723 9:21195707-21195729 ACAGAAAAGCAGGGAGGAGAGGG + Intergenic
1052728933 9:32262717-32262739 ATGGAGCAGCAATGAGGGGCAGG - Intergenic
1052871753 9:33514401-33514423 AATGAGAAGCAGTTAGGGGCTGG + Intergenic
1053685960 9:40522953-40522975 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1053711377 9:40812986-40813008 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1053715723 9:40885307-40885329 ATGGAGAATCAGGGATGGTCTGG + Intergenic
1053786051 9:41653675-41653697 AGAGAGAGACAGGGAGAGGCAGG - Intergenic
1053935913 9:43151226-43151248 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054076825 9:60545431-60545453 ATGGAGAATCAGGGATGGTCTGG - Intergenic
1054277775 9:63102016-63102038 ACAGAGACGCAGGGAGGAGATGG + Intergenic
1054299042 9:63358406-63358428 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054366226 9:64344072-64344094 AAAGAGAGGCAAGGAGGAGCAGG + Intergenic
1054397061 9:64662914-64662936 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054421289 9:64933803-64933825 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054431703 9:65168106-65168128 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054498675 9:65853401-65853423 ACAGAGACGCAGGGAGGAGATGG + Intergenic
1054735403 9:68745207-68745229 GGGGAGAAGCAGGGAGGGGCAGG + Intronic
1054746185 9:68856243-68856265 ATAGAGAAGCAGTAAGGTTCGGG - Intronic
1054927297 9:70601673-70601695 ATAGAATAGCAGGGAGGGCAGGG - Intronic
1055045915 9:71923562-71923584 CTAGAAAAGCAGGGAAGGGCTGG - Intronic
1055514025 9:77019498-77019520 AGAGAGAAGCAGAGAGGGCCTGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056512828 9:87321869-87321891 ATGGAGTAGGAGGAAGGGGCTGG - Intergenic
1056546468 9:87617838-87617860 CTAGAGAAGCAGAGGGGAGCAGG - Intronic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057685852 9:97233553-97233575 AATGAGAAGCAGTTAGGGGCTGG - Intergenic
1057721270 9:97534012-97534034 ATAGAGAAAAAGGGATGGGGAGG + Intronic
1057729868 9:97598997-97599019 ATGAGGATGCAGGGAGGGGCAGG - Intronic
1058178494 9:101767108-101767130 GTGGAGAAGCAGGGAGATGCAGG + Intergenic
1059322513 9:113480655-113480677 AAAGAGGAGCAGGGAGGGTGTGG + Intronic
1059405593 9:114096977-114096999 ATAGAGGAGAATGGATGGGCAGG + Intronic
1059933161 9:119281477-119281499 AGGGAGAAGAAGGGAGGAGCAGG + Intronic
1060294163 9:122332073-122332095 ATAGAGACGGAGGGAGGGGTGGG - Intergenic
1060600561 9:124874674-124874696 GGAGAGAGGGAGGGAGGGGCAGG - Intronic
1060673004 9:125486815-125486837 GTAGGAAAACAGGGAGGGGCCGG - Intronic
1060786666 9:126456564-126456586 AGCTGGAAGCAGGGAGGGGCAGG - Intronic
1060810166 9:126607295-126607317 ATAAGGCAGCAGGGTGGGGCAGG - Intergenic
1060995660 9:127873856-127873878 GCAGAGAACCAGAGAGGGGCAGG - Intronic
1061026850 9:128055349-128055371 AGGGAGAAGAAGGGAGGGGAAGG + Intergenic
1061487218 9:130926017-130926039 AGAGAGGAGCAGAGATGGGCAGG + Intronic
1061499535 9:130993971-130993993 AAACAGGAGCAGGGAGGAGCTGG - Intergenic
1061595337 9:131625208-131625230 CTAGTGAAGCAGGGAGAGGGCGG + Intronic
1062453246 9:136624245-136624267 ATGGAGGACCAGGGAGGGACAGG - Intergenic
1062527690 9:136984955-136984977 AGAGAGGGGCAGGGAGGGGCCGG - Exonic
1062670312 9:137704956-137704978 AGAGAGAGGGAGGGAGGGGAGGG - Intronic
1062751210 9:138255131-138255153 AGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1185533101 X:837737-837759 ATAGAGCAGGAAGCAGGGGCAGG + Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185611162 X:1394452-1394474 AGAGAGAGGCAGGGAAAGGCAGG - Intergenic
1185780325 X:2838448-2838470 AGAGAGAGGAAGGGAGGGGAGGG - Intronic
1186076748 X:5887801-5887823 ACACAGAAGCAAGGAGAGGCAGG - Intronic
1186637177 X:11419075-11419097 ACAGAGAAGCAGGGATAGACTGG - Intronic
1186852086 X:13590607-13590629 AGAGAGAAGGAGGTTGGGGCAGG - Intronic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187352044 X:18528571-18528593 AGAGAGAGGCAGGGAGGGAAGGG - Intronic
1187405049 X:18996501-18996523 ATAGGGAGGGAGGGAGAGGCAGG - Intronic
1187549537 X:20288139-20288161 ATAGAGAACAATGGAGGGGAAGG - Intergenic
1187882873 X:23862844-23862866 AGGGAGAAGGAGGGAGGGGAGGG + Intronic
1188817395 X:34731876-34731898 AGAAAGAAGGAGGGAGAGGCTGG + Intergenic
1189216610 X:39330606-39330628 TTTAAGAAGCAGGGAGGGCCAGG + Intergenic
1189255128 X:39632040-39632062 AAAGAGATGTAGGGAGGCGCTGG + Intergenic
1189419414 X:40843438-40843460 AAAGGGAAGAAGGGTGGGGCAGG - Intergenic
1189744671 X:44157689-44157711 CGGGAGAAGCAGGGAGGGACTGG - Intronic
1190280385 X:48925376-48925398 TTAGGGGAGCGGGGAGGGGCGGG - Intronic
1190731574 X:53229963-53229985 ACAGAGTAACAGGGAGTGGCTGG + Intergenic
1190740942 X:53288387-53288409 CTAGGGAAGGAGGGAGGGGGTGG - Intronic
1190879398 X:54482344-54482366 CCAGAGAAGCAGGGAGGAGGTGG - Intronic
1192442099 X:71182298-71182320 AGAGAGAGGACGGGAGGGGCGGG - Intergenic
1193690414 X:84634687-84634709 ATAGAGCATCAGGTAGGTGCAGG - Intergenic
1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG + Intergenic
1195389829 X:104349899-104349921 ATAAAGAATTAAGGAGGGGCTGG - Intergenic
1195731370 X:107971437-107971459 AGAGAGGAGCAGGGCGGGGTAGG - Intergenic
1196157965 X:112451854-112451876 ACAGAGAAGTAGGGATGGGGAGG - Intergenic
1196329515 X:114454264-114454286 ATAGAGAAGCAAGATAGGGCAGG + Intergenic
1196344731 X:114640925-114640947 AGAAAGAAGGAGGGAGGGGGAGG - Intronic
1197171915 X:123444147-123444169 ACAAAGAAGGAGGGAGGGGGAGG - Intronic
1197303776 X:124814764-124814786 ATAAAGGAAAAGGGAGGGGCAGG + Intronic
1197710964 X:129667032-129667054 ATGGAGCAGAGGGGAGGGGCTGG - Intergenic
1197710988 X:129667102-129667124 ATGGAGGAGAGGGGAGGGGCTGG + Intergenic
1197816402 X:130503081-130503103 AGAGAGAAAGAGGGAGGGGGAGG - Intergenic
1199553553 X:149081537-149081559 AAAGACAATCAGGTAGGGGCAGG - Intergenic
1199649585 X:149939184-149939206 CTGGAGAAGCAGGGCAGGGCTGG + Intergenic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1200075863 X:153550290-153550312 AGTGAGCAGCAGGGAGGTGCCGG + Intronic
1200122990 X:153800072-153800094 AGAGAGCAGCACTGAGGGGCCGG + Intergenic
1200319248 X:155168435-155168457 ATAGAGAGGGAGGGCTGGGCAGG + Intergenic
1201296449 Y:12467219-12467241 AGAGAGAAGCAGGGTTGGGGTGG - Intergenic