ID: 1170146834

View in Genome Browser
Species Human (GRCh38)
Location 20:13184724-13184746
Sequence ATGGCAAAAAGCAGAAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170146834_1170146840 30 Left 1170146834 20:13184724-13184746 CCCACACTTCTGCTTTTTGCCAT No data
Right 1170146840 20:13184777-13184799 TGAGGAGGATAAGAGACATATGG No data
1170146834_1170146837 5 Left 1170146834 20:13184724-13184746 CCCACACTTCTGCTTTTTGCCAT No data
Right 1170146837 20:13184752-13184774 ATACATATTTAAGAAGTTTTTGG No data
1170146834_1170146838 12 Left 1170146834 20:13184724-13184746 CCCACACTTCTGCTTTTTGCCAT No data
Right 1170146838 20:13184759-13184781 TTTAAGAAGTTTTTGGTCTGAGG No data
1170146834_1170146839 15 Left 1170146834 20:13184724-13184746 CCCACACTTCTGCTTTTTGCCAT No data
Right 1170146839 20:13184762-13184784 AAGAAGTTTTTGGTCTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170146834 Original CRISPR ATGGCAAAAAGCAGAAGTGT GGG (reversed) Intergenic
No off target data available for this crispr