ID: 1170147602

View in Genome Browser
Species Human (GRCh38)
Location 20:13193945-13193967
Sequence CTAGCCTACCTTGCATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170147602_1170147604 21 Left 1170147602 20:13193945-13193967 CCTGTAGATGCAAGGTAGGCTAG No data
Right 1170147604 20:13193989-13194011 TCAATCTATGTAATTTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170147602 Original CRISPR CTAGCCTACCTTGCATCTAC AGG (reversed) Intergenic
No off target data available for this crispr