ID: 1170149996

View in Genome Browser
Species Human (GRCh38)
Location 20:13219650-13219672
Sequence CCAGCATCTTATTAATAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170149996_1170149998 7 Left 1170149996 20:13219650-13219672 CCAATTTATTAATAAGATGCTGG No data
Right 1170149998 20:13219680-13219702 TAGAATTTTAAAGATGCTTCAGG No data
1170149996_1170149999 18 Left 1170149996 20:13219650-13219672 CCAATTTATTAATAAGATGCTGG No data
Right 1170149999 20:13219691-13219713 AGATGCTTCAGGCATCTTTAAGG No data
1170149996_1170150000 21 Left 1170149996 20:13219650-13219672 CCAATTTATTAATAAGATGCTGG No data
Right 1170150000 20:13219694-13219716 TGCTTCAGGCATCTTTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170149996 Original CRISPR CCAGCATCTTATTAATAAAT TGG (reversed) Intergenic
No off target data available for this crispr