ID: 1170149998

View in Genome Browser
Species Human (GRCh38)
Location 20:13219680-13219702
Sequence TAGAATTTTAAAGATGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170149996_1170149998 7 Left 1170149996 20:13219650-13219672 CCAATTTATTAATAAGATGCTGG No data
Right 1170149998 20:13219680-13219702 TAGAATTTTAAAGATGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170149998 Original CRISPR TAGAATTTTAAAGATGCTTC AGG Intergenic
No off target data available for this crispr