ID: 1170157767

View in Genome Browser
Species Human (GRCh38)
Location 20:13284319-13284341
Sequence CTGGGTTTCAAGGATGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170157767_1170157772 -1 Left 1170157767 20:13284319-13284341 CCAGCGGCATCCTTGAAACCCAG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1170157772 20:13284341-13284363 GCTCTCAGCCCACTGCACTCGGG 0: 1
1: 0
2: 4
3: 41
4: 455
1170157767_1170157771 -2 Left 1170157767 20:13284319-13284341 CCAGCGGCATCCTTGAAACCCAG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1170157771 20:13284340-13284362 AGCTCTCAGCCCACTGCACTCGG 0: 1
1: 0
2: 0
3: 24
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170157767 Original CRISPR CTGGGTTTCAAGGATGCCGC TGG (reversed) Intronic
901768488 1:11518663-11518685 CAGGGTTTCATGGCTGCCGAGGG - Intronic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
905472664 1:38205478-38205500 CTGGCTCTCCAGGAAGCCGCTGG + Intergenic
909049856 1:70754060-70754082 GTGGGTTTCAGGGATGGCACAGG - Intergenic
912427358 1:109606334-109606356 CTTGGTTTCAATGATGCCCGTGG + Exonic
913273468 1:117116682-117116704 CTGCTTTGTAAGGATGCCGCAGG - Exonic
914845874 1:151283165-151283187 CTGGGTTTCGAGGAGGGGGCGGG - Intronic
1068770093 10:60811067-60811089 CTCGGTTACAAGGATGCAGGAGG + Intergenic
1069537008 10:69261252-69261274 CTTGGTTTCGAAGATGCCCCTGG - Exonic
1069555495 10:69395063-69395085 CTTGGTCTCAAAGATGCCCCGGG - Exonic
1076691983 10:132228471-132228493 CTGCGTTTCAAGTCTGCAGCAGG + Intronic
1077504502 11:2923839-2923861 CTGGGTTTCCAAGCTGCTGCTGG - Intronic
1078180462 11:9006011-9006033 CTTGGCTTCAAGGAAGCCCCAGG + Intergenic
1078659143 11:13272041-13272063 CTGGGTTTCAAAGAATCAGCTGG - Intergenic
1078991787 11:16655151-16655173 CTGGGATTCTAGGATGCAGATGG + Intronic
1082867118 11:57910512-57910534 CTGGGTTTCAAGGACAAAGCTGG - Intergenic
1085052684 11:73387884-73387906 CTGGGTTCCCAGGCTGCCCCTGG + Intronic
1085272489 11:75278514-75278536 CTGGCCTGCAAGGATGCCTCAGG - Intronic
1091970401 12:4781836-4781858 CTGGGAATCAAGGATGGGGCTGG + Intronic
1092690107 12:11099403-11099425 CTGGGTTTGATGGATGGCTCTGG - Intronic
1092999111 12:13979270-13979292 CTGGAATTGAAGGATGCTGCAGG - Intronic
1096614897 12:52826705-52826727 CTGGGTTCCACAGATGCCCCAGG + Intronic
1097854901 12:64452129-64452151 CTGAGTCTCGAGGAGGCCGCGGG + Exonic
1103917558 12:124383934-124383956 CTGGCTTTCCAGGCTTCCGCAGG - Intronic
1104042035 12:125136833-125136855 CTTGGTTTCCAGGATGAGGCTGG - Exonic
1106071225 13:26413022-26413044 CTGACTTTCAAGCATGCCTCAGG - Intergenic
1109785575 13:67170695-67170717 CTTGGCTTCAAGCATTCCGCCGG - Intronic
1110439907 13:75516385-75516407 CTGTGGTTCAAGAATGCCCCGGG + Intergenic
1110802163 13:79711252-79711274 CTGGCTTTCAATGATGCCAGTGG + Intergenic
1113317618 13:109199681-109199703 CTGGGGATTAAGGATGCTGCTGG - Intronic
1113759233 13:112835983-112836005 CTGGATTTGAAGGACGCAGCAGG - Intronic
1121819551 14:96955155-96955177 CTGGGATTCAGGAATGCCCCAGG - Intergenic
1129703025 15:77778802-77778824 TTGGGTTTTAAGGATTCCTCTGG - Intronic
1131875265 15:96799086-96799108 CTTGGTATCAAAGATGCCTCTGG - Intergenic
1132089926 15:98939886-98939908 CTGGGTTTCACGGCTGGGGCTGG + Intronic
1133417225 16:5616214-5616236 CTGGGGTTCCAGGAAGCCGAAGG - Intergenic
1134002678 16:10794874-10794896 CAGGGTTTCCAGGCTGCCCCTGG + Intronic
1136178219 16:28533171-28533193 CTGAGTTACCAGGATGCTGCTGG - Intronic
1137511888 16:49107877-49107899 CTGAATTTAAAGGATGCAGCAGG + Intergenic
1137568750 16:49550952-49550974 CTGGGTTTGCAGGAAGCTGCTGG + Intronic
1139361963 16:66405536-66405558 CTGGGTTTCAAGGCTACCACAGG + Intergenic
1141588793 16:85053321-85053343 CTGGGTCTAAAAGATGCCTCTGG - Intronic
1144949544 17:18986583-18986605 CTGAGTTTCCAGGAAGCCGGAGG - Intronic
1148114917 17:45169871-45169893 CTGGGTCTCAAGGAGGCAGGTGG + Exonic
1154408470 18:14119169-14119191 CTGGGTCACAAGGGTGCTGCTGG - Intronic
1160121464 18:76134007-76134029 CTGGTTTTCAAGGATACTGTAGG + Intergenic
1160964177 19:1738685-1738707 CTGGGCTTCAATGAGGCCCCCGG - Intergenic
1161137092 19:2626275-2626297 GTGGGTTTCCACGGTGCCGCTGG - Intronic
1163131967 19:15279829-15279851 CTGGGTTTCAAGAGGTCCGCTGG - Intronic
1164453365 19:28385924-28385946 CTGGTTTTGAAGGCTGCTGCGGG - Intergenic
1165374317 19:35431078-35431100 GTGGGTTTTAAGGATTCCTCTGG - Intergenic
1165383376 19:35496075-35496097 CTGTGTTTCCAGGATGCAGAGGG - Intergenic
1166139454 19:40798332-40798354 CTGGGACTCAAGGCTCCCGCCGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167792595 19:51690858-51690880 CTGGGTTCCCAGCATGCCCCGGG - Intergenic
1168587461 19:57604956-57604978 CTGGGATTCGAGGATGGCTCTGG + Intronic
926083788 2:10008752-10008774 TTGGTTTTCAAGGCTCCCGCAGG + Intergenic
929712064 2:44275678-44275700 CTGGGAGCCAAGGATGCCCCTGG - Exonic
930352018 2:50268587-50268609 CTGGGTTCCAAGGATCCCAGGGG + Intronic
930426208 2:51216268-51216290 TTGGCTTTCAAGGTTGCCTCTGG - Intergenic
937872042 2:126792866-126792888 CTGGGTGCCAAGGATGGTGCAGG + Intergenic
938306917 2:130262824-130262846 CTGGGTTTCAGGGTTGGAGCTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
938694553 2:133823435-133823457 CTGGGTTTGATGGAGGCAGCAGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
946229107 2:218280667-218280689 CTGGGGTTCAGAGATGCTGCAGG + Intronic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
1170153644 20:13250291-13250313 CTAGCTTTCAAGGATGTGGCTGG + Intronic
1170157767 20:13284319-13284341 CTGGGTTTCAAGGATGCCGCTGG - Intronic
1170900143 20:20454622-20454644 CTGCCTTCCAAGGATGCCACAGG + Intronic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172936333 20:38623166-38623188 CTGGTTTCCAAGGATCCCGCAGG + Intronic
1173083078 20:39888300-39888322 CTTGGTTTAAAGGAAGCCTCAGG - Intergenic
1175418191 20:58815573-58815595 CTGGGGTGCACAGATGCCGCAGG + Intergenic
1175539998 20:59742529-59742551 TTGGGTTCCAAGGCTGCCCCAGG + Intronic
1178441935 21:32605406-32605428 CTGGGTTTCAAGGAAGGGGCTGG + Intronic
1179128299 21:38611775-38611797 CTGGGTGCCGAGGATGCAGCGGG - Intronic
1179805883 21:43836681-43836703 CTGGTTTTCAAGGCTACTGCAGG - Intergenic
1180604259 22:17044776-17044798 CTGGGTTTCAATTCTGCCTCTGG - Intergenic
1181748501 22:24972754-24972776 CTGGGCACCAAGGATGCAGCAGG + Intronic
1182736359 22:32534276-32534298 CTGGGTGTCCAGGATGACTCCGG - Intronic
955664961 3:61340371-61340393 CTGGGTTTCTATGATGACGATGG - Intergenic
960097980 3:113706541-113706563 CTGTGTTTCAGGGAGGCCTCAGG + Intergenic
960995709 3:123338910-123338932 CTGGGTGTCCAGGGTGCTGCAGG - Intronic
961132020 3:124477752-124477774 CTGAGTTTTAAGGAGGCCTCTGG + Intronic
962339684 3:134571315-134571337 CTGTGTGTCAGGGATGCCTCTGG + Intronic
967899436 3:194434437-194434459 CTGAGTATCAAGAATGCAGCAGG + Intronic
968378228 4:63745-63767 CTGGGTCACAAGGGTGCTGCTGG - Intronic
968394659 4:223767-223789 CTGGGTCACAAGGGTGCTGCTGG + Intergenic
968400433 4:290811-290833 CTGGGTCACAAGGGTGCTGCTGG - Intronic
968407008 4:349690-349712 CTGGGTCACAAGGGTGCTGCTGG + Intronic
968419230 4:468659-468681 CTGAGTCTCAAGGGTGCTGCTGG - Intronic
968714264 4:2142843-2142865 CTGGGTATCAAGGATGGCGGAGG - Intronic
971189594 4:24414678-24414700 TTGTGTTTCAAGTATGCAGCTGG + Intergenic
980063530 4:128156460-128156482 CTGGGCTTCCAGGATTCCTCCGG - Intronic
982342055 4:154310590-154310612 CTGCTTTTCAAGGATGCTGATGG - Intronic
982539242 4:156646753-156646775 CTTGGATTCAAGGATGCTGCGGG + Intergenic
988254950 5:28809314-28809336 CTGTGTTTCCCGGATGCCGGAGG + Intergenic
998370201 5:141655869-141655891 CTGGGCTTTAAGGATGCTGGTGG + Exonic
999703737 5:154252026-154252048 CTGGTTTTCAAGGATACAGGAGG + Intronic
1002373444 5:178772438-178772460 CTTGGTTTCCAGGATGAGGCTGG + Intergenic
1003948014 6:11093199-11093221 CTTGGTCTCAAGGAGGCAGCTGG + Intergenic
1005215547 6:23523275-23523297 CTGGGTTTCCAGGAAGGAGCAGG - Intergenic
1006599584 6:35216534-35216556 CTGGGTTACAGGGATGTCTCTGG + Intronic
1009864256 6:69376734-69376756 CTGGGGCTCAGGGATGGCGCAGG - Intronic
1011222196 6:85066485-85066507 CTTGGTTCCAAGGGTGCGGCTGG - Intergenic
1017380977 6:153829241-153829263 CTGGGTTTCAATCATGGCTCTGG + Intergenic
1018353492 6:162987883-162987905 CTGGTTATCCAGGATGCTGCAGG + Intronic
1019909700 7:4092404-4092426 CTGGGCTTCATGGGTGCCTCTGG - Intronic
1022835517 7:34110093-34110115 CTGTGTGTCAAGGTTTCCGCTGG + Intronic
1024328007 7:48127545-48127567 CTGGTTTTCCAGGATGTTGCAGG + Intergenic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1026033754 7:66816372-66816394 CTGGGCTTGAAGGATCCAGCTGG + Intergenic
1026985862 7:74554981-74555003 CTGGGCTTGAAGGATCCAGCTGG - Intronic
1031351852 7:120742544-120742566 CTGGGTTTCAAAGCTGGAGCCGG - Exonic
1032089628 7:128904699-128904721 CTGGTTTTCCAGGCTGCCCCAGG - Intronic
1035006208 7:155662921-155662943 CTGAGTTTCAAGGATGAAGAGGG + Intronic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1041339255 8:56824257-56824279 CTGGGTGCCAAGAATGCCCCAGG - Intergenic
1041724614 8:61006393-61006415 CTTACTCTCAAGGATGCCGCTGG + Intergenic
1042722197 8:71838475-71838497 CTGGGTTTGAAGGATTTCTCTGG + Intronic
1044535756 8:93354858-93354880 CTGGGATTCAAGGGAGCCCCAGG - Intergenic
1044940298 8:97335233-97335255 CTGGGTTTCAAGCATGAAACTGG - Intergenic
1052096631 9:24391575-24391597 CTGGGTTTCAAGCACGAAGCTGG - Intergenic
1058537095 9:105972855-105972877 CAGGATTCCAAGGATGCCCCAGG - Intergenic
1061702046 9:132423345-132423367 CTGGGTTTCCAGGAGGCTCCTGG + Intronic
1203571012 Un_KI270744v1:130505-130527 CTGGGTCACAAGGGTGCTGCTGG + Intergenic
1188393136 X:29645695-29645717 GTGGGTTTCAGGCATGCCCCAGG + Intronic
1191108580 X:56788059-56788081 CTAGGTTTCATGGCTCCCGCAGG - Intergenic
1192013407 X:67299904-67299926 CTGAGTTACAAGGATGCATCAGG - Intergenic
1193645664 X:84066150-84066172 CTGGGTTTCAAGGATAAAACTGG + Intronic
1195850354 X:109276053-109276075 CTGGGTTTTGAGGATGCCAGTGG - Intergenic
1197709685 X:129656523-129656545 CTGGGTCTCAAGGATGAAGAGGG - Intergenic
1199928624 X:152495491-152495513 CTGGGTCACATGGATGCTGCTGG + Intergenic
1201987452 Y:19985481-19985503 CTGGGTTTCAAGCATGAAACTGG - Intergenic