ID: 1170158687

View in Genome Browser
Species Human (GRCh38)
Location 20:13291259-13291281
Sequence CTGGCTATTGCAGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170158682_1170158687 -4 Left 1170158682 20:13291240-13291262 CCTTTCTGCCTCTCAGTTCCTGG 0: 1
1: 0
2: 6
3: 60
4: 589
Right 1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 178
1170158679_1170158687 8 Left 1170158679 20:13291228-13291250 CCCTCCTTGCATCCTTTCTGCCT 0: 1
1: 2
2: 38
3: 1522
4: 43712
Right 1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 178
1170158681_1170158687 4 Left 1170158681 20:13291232-13291254 CCTTGCATCCTTTCTGCCTCTCA 0: 1
1: 2
2: 5
3: 57
4: 754
Right 1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 178
1170158678_1170158687 13 Left 1170158678 20:13291223-13291245 CCTCACCCTCCTTGCATCCTTTC 0: 1
1: 0
2: 8
3: 173
4: 1093
Right 1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 178
1170158680_1170158687 7 Left 1170158680 20:13291229-13291251 CCTCCTTGCATCCTTTCTGCCTC 0: 1
1: 0
2: 6
3: 74
4: 1094
Right 1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170158687 Original CRISPR CTGGCTATTGCAGCTTTTCT GGG Intronic
907859367 1:58336293-58336315 CTGGCGTTTGAAGGTTTTCTGGG + Intronic
908776531 1:67646376-67646398 CTGGACATTGCTGCTGTTCTAGG - Intergenic
909906094 1:81197224-81197246 CTTACTATTGCTGCTTCTCTCGG - Intergenic
911133388 1:94414174-94414196 AAGGCTATTGCAGTTTATCTTGG + Intergenic
911270679 1:95797638-95797660 CTGGCTACAGCAGCTTTGCTGGG - Intergenic
912882314 1:113427658-113427680 CTGTCTCTTGCAGTATTTCTTGG + Intronic
915854825 1:159371833-159371855 CTGTCTATTTCTGCTTGTCTGGG - Intergenic
917035237 1:170741586-170741608 CTGGCTCTGGCAGCATATCTCGG - Intergenic
917377304 1:174363254-174363276 TTGGCTATTCAAGCTTTTCTGGG + Intronic
917498742 1:175566534-175566556 CTGCCTGCTGCAGATTTTCTGGG + Intronic
918613423 1:186517256-186517278 CTGGCTATTGCCATGTTTCTAGG - Intergenic
919019513 1:192085811-192085833 CTAGCATTTTCAGCTTTTCTGGG - Intergenic
923214363 1:231834774-231834796 GTGGCAAGTACAGCTTTTCTAGG - Intronic
923458856 1:234189210-234189232 CTGGCAATTCAAGCATTTCTTGG - Intronic
924800085 1:247323014-247323036 CTGCCTATTTTAGCTTTTCTGGG + Intronic
1063543392 10:6957007-6957029 ATGACTCTGGCAGCTTTTCTAGG - Intergenic
1064250514 10:13703110-13703132 TTGTCTAATTCAGCTTTTCTGGG - Intronic
1065368150 10:24954233-24954255 CTGGTTAATGCAGCTTCACTGGG + Intergenic
1065897504 10:30177027-30177049 CTGGCTAGTTTAGCTTTTTTGGG + Intergenic
1065909440 10:30288610-30288632 CTGGCTAGTTTAGCTTTTTTGGG + Intergenic
1065968626 10:30788313-30788335 CTGGCTATTGCAGCTCTGGCTGG + Intergenic
1065988440 10:30981328-30981350 CGGATTATTTCAGCTTTTCTAGG - Intronic
1067107126 10:43373827-43373849 CTGGCTTTTGCTGCCTTTGTGGG - Intronic
1067160682 10:43822320-43822342 CTGGCTCTTCCACCTTTGCTGGG - Intergenic
1069286254 10:66719576-66719598 CTGGTCATAGCAGTTTTTCTGGG - Intronic
1071740832 10:88356108-88356130 CTGTCTGTCGCAGCTTTGCTTGG + Intronic
1072224904 10:93360004-93360026 CTGGCAAATGCATCTCTTCTGGG - Intronic
1073951451 10:108814016-108814038 CTTGCCACTGCAGCTTTACTAGG - Intergenic
1074986522 10:118664555-118664577 CTGACTCTGGCAGCCTTTCTTGG + Intergenic
1075086074 10:119415299-119415321 CTGGCTACTGGACCTTTGCTTGG - Intronic
1077984439 11:7336821-7336843 CTGGCTATTCGAGCTCTTTTTGG + Intronic
1089343879 11:117777909-117777931 CTGGATGTTCCAGCTTTGCTTGG - Intronic
1091249518 11:134130801-134130823 ATGTCTATTCCAGCCTTTCTGGG + Intronic
1096053055 12:48628115-48628137 ATGGCTGTTGCAGAGTTTCTTGG + Intergenic
1098074811 12:66717855-66717877 TTGGTTAATGCAGCTATTCTTGG + Intronic
1101747818 12:107557347-107557369 ATTTTTATTGCAGCTTTTCTAGG - Intronic
1105986322 13:25570920-25570942 CTGGGTGTTGCAGTTATTCTTGG + Intronic
1107655901 13:42591856-42591878 CTGGCTAAGGCAGCTTTCCAAGG + Intronic
1107775097 13:43830489-43830511 CTTGATATTGCAGCCTTGCTCGG - Intronic
1109471492 13:62811675-62811697 TTGGCTATTTGAGCTTTTTTGGG + Intergenic
1109712330 13:66177930-66177952 TTGGCTATTGCAGCAATTCTCGG + Intergenic
1114133538 14:19820655-19820677 CTGGCTATAGCTGCTTTGCTGGG + Intronic
1114341963 14:21754491-21754513 CTGGCCACAGCAGCCTTTCTGGG - Intergenic
1114694242 14:24611977-24611999 TTGGCTGTTACTGCTTTTCTGGG + Intergenic
1115077637 14:29411146-29411168 CTGCCTTTTGCAATTTTTCTTGG - Intergenic
1117502695 14:56369491-56369513 TTGGCTATTCAGGCTTTTCTTGG + Intergenic
1118926989 14:70200019-70200041 CTGGCCACAGCAGCTTTACTGGG + Intergenic
1119965369 14:78909457-78909479 CTTGCTATTGAAGCTTTCTTGGG - Intronic
1122593871 14:102875043-102875065 CAGGCTAATGCTGCTTTTTTTGG + Intronic
1123576610 15:21676224-21676246 CTGGCTATAGCTGCTTTGCTGGG + Intergenic
1123613232 15:22118692-22118714 CTGGCTATAGCTGCTTTGCTGGG + Intergenic
1124446830 15:29742099-29742121 CTGGCTATTTTGGGTTTTCTGGG - Intronic
1127462488 15:59212121-59212143 CTGGCTATTGCACTCTTACTTGG + Intronic
1128880331 15:71236642-71236664 TTTGTTATTTCAGCTTTTCTAGG + Intronic
1128997151 15:72305652-72305674 CTGGCTCTTCCTACTTTTCTTGG + Intronic
1130367543 15:83253903-83253925 CTGGCTCTCCCAGCTTTCCTTGG + Intergenic
1130553031 15:84904101-84904123 CTAGCTCTTGCTGCTTTCCTGGG + Exonic
1131731938 15:95291027-95291049 CTGGGTTTTCCAGCTTTCCTGGG + Intergenic
1202985478 15_KI270727v1_random:410469-410491 CTGGCTATAGCTGCTTTGCTGGG + Intergenic
1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG + Intergenic
1137767505 16:50989391-50989413 CTGGCTGGGGCAGCTTGTCTTGG + Intergenic
1138440517 16:57031903-57031925 CTGGCTATTCCAGCTGTGCATGG + Intronic
1143368062 17:6421283-6421305 CTGCCTATTTCAGCTTTTAGAGG - Intronic
1145790495 17:27623793-27623815 ATGGTAATTGCAGCTGTTCTTGG + Exonic
1146737004 17:35247024-35247046 CTGGTTACTGCAGCAGTTCTGGG - Intronic
1146904497 17:36609224-36609246 CTGGCTCCTGCTGCTTTCCTGGG - Intergenic
1147536871 17:41327256-41327278 CTGGGTATTGGAGCCTTCCTGGG - Intergenic
1148891104 17:50807796-50807818 CTGGCTCTTCCAGCTTCTATTGG - Intergenic
1150153231 17:62828320-62828342 CTTGCTATTACAGCTTTTAATGG - Intergenic
1150619092 17:66795740-66795762 ATGGCCATTACAACTTTTCTTGG + Intronic
1153487190 18:5611603-5611625 CTCTCTAATGAAGCTTTTCTTGG - Intronic
1153819210 18:8818735-8818757 GTGGTTAATGCAGATTTTCTGGG + Intronic
1155993793 18:32308336-32308358 ATGCCTCTAGCAGCTTTTCTTGG - Intronic
1157343779 18:46804884-46804906 CTCTCTACTGCTGCTTTTCTTGG - Intergenic
1157429586 18:47613772-47613794 CTACCTATTGCAGCCTCTCTGGG - Intergenic
1159244590 18:65789411-65789433 CTGGCTGTTGCTGGTTGTCTTGG - Intronic
1160127988 18:76196208-76196230 CTAGCTATTGTAACTTTTGTGGG - Intergenic
1160574891 18:79847702-79847724 GTGGCAGTTGCAGCTTTTCCCGG + Intergenic
1164605403 19:29594358-29594380 ATTGCTCTGGCAGCTTTTCTAGG - Intergenic
1165071140 19:33255440-33255462 GTATCTATTGCAGCTTTTTTTGG + Intergenic
1166326499 19:42054165-42054187 CTGGCTGTTGCTGCCTATCTGGG - Intronic
1166917758 19:46207255-46207277 CTCGCCATTGCCACTTTTCTTGG + Intergenic
925894735 2:8462700-8462722 CTGACTATAGCAGCTTTCATGGG - Intergenic
929484733 2:42343148-42343170 CTGGCTGTGGCTGCTGTTCTGGG - Intronic
932435075 2:71698531-71698553 CTGCCTAATGCAGCTTCTCTGGG - Intergenic
933335152 2:80948715-80948737 CTGATTATTGCTCCTTTTCTGGG - Intergenic
937603295 2:123766870-123766892 CTGGCTGAAGCAGCTTTTGTAGG + Intergenic
937653994 2:124353808-124353830 CTGGGTATTGTAGTTTTTCATGG + Intronic
938594730 2:132776506-132776528 CTGGCTCTTTCAGCTCTCCTGGG + Intronic
941081246 2:161063133-161063155 TTGGCTGTTGCAGAGTTTCTTGG + Intergenic
942357756 2:175137377-175137399 ATGGCTATTACAGATTTCCTTGG - Intronic
946531250 2:220572670-220572692 CAGGCTATGGCAGCTGTACTCGG - Intergenic
946885950 2:224222765-224222787 CTGGCTATTGCAGGAATTCAGGG + Intergenic
948297484 2:236873173-236873195 TTGGCACTTGCAGCTGTTCTTGG + Intergenic
948403451 2:237701068-237701090 CTGAGCATTGAAGCTTTTCTGGG - Intronic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1171000871 20:21414249-21414271 CTGGCTACAGCAGCTTTGCTGGG - Intergenic
1171819013 20:29816265-29816287 ATGGCTATTTCTGCTTTTTTTGG + Intergenic
1171898803 20:30836915-30836937 ATGGCTATTTCTGCTTTTGTTGG - Intergenic
1176218619 20:63959647-63959669 CTGGCTATTGCACTTCTGCTGGG + Exonic
1178660307 21:34502173-34502195 CTTGCTAATAGAGCTTTTCTTGG + Intergenic
1179216415 21:39370849-39370871 TTGGCTTTTGCCGCCTTTCTGGG + Intergenic
1179265219 21:39797080-39797102 CAGGCTAGTCCAGCATTTCTAGG + Intronic
1180322990 22:11340964-11340986 ATGGCTATTTCTGCTTTTTTTGG + Intergenic
1182104205 22:27677652-27677674 CTGTCTATTTCAGCTTCTCATGG - Intergenic
1184364372 22:44040584-44040606 CTGGCTTTTGCAGCTTTCAGAGG - Intronic
1185156827 22:49198098-49198120 ATCTCTATTGCAGCTTTTCCAGG - Intergenic
950178764 3:10896113-10896135 CCAGCTGTTGCAGCATTTCTGGG + Intronic
951265537 3:20561400-20561422 CTGTCTTTTACAGTTTTTCTCGG - Intergenic
952226176 3:31378712-31378734 CTCCCTACTGCAGCTCTTCTAGG + Intergenic
953875636 3:46665165-46665187 CTGCCTATTGCTGGTTCTCTTGG - Intergenic
954055761 3:48022982-48023004 TTGGATATTGCAGCTTTAATAGG - Intronic
955783437 3:62510534-62510556 CAGGCTTTTGCATCTTTTTTTGG + Intronic
956710590 3:72035376-72035398 CTGTCTCTGGCAGCTTTTCTTGG + Intergenic
957129039 3:76199616-76199638 CTGGCTGTTGCAGAGTTTGTGGG - Intronic
957570318 3:81939099-81939121 ATGGCTACTGTAGCTTTTCCAGG - Intergenic
957851970 3:85819767-85819789 CTGCTTTTTGCAGTTTTTCTAGG + Intronic
957922099 3:86759568-86759590 CAGTCTATTGCAGCATCTCTAGG - Intergenic
958577754 3:95974273-95974295 TTGAGTATTGCAGCTTTTCTAGG - Intergenic
958910862 3:99993131-99993153 TTGGCTATTTGAGCTTTTTTTGG + Intronic
959094626 3:101940544-101940566 CTAGGTATTGCTGCTTCTCTTGG - Intergenic
960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG + Exonic
963928797 3:150980008-150980030 CTAGCTATGGCTGCTTATCTTGG - Intergenic
967102559 3:186228310-186228332 CTGGGGATTGCCTCTTTTCTGGG + Intronic
967518681 3:190402142-190402164 CTGACAATTGAAGCCTTTCTGGG - Intronic
974090259 4:57303280-57303302 CCGTCTGTTGCAGCTTTGCTTGG + Intergenic
975229614 4:71916645-71916667 CTGTCTATTGCAACTATTTTGGG + Intergenic
976992727 4:91388220-91388242 GAGGTTATGGCAGCTTTTCTTGG - Intronic
978542820 4:109837164-109837186 CTGGCTATGGCTGCTTTTACAGG - Intronic
982224399 4:153152922-153152944 CTGGCATTTGCACCTTTTCATGG + Intronic
983379142 4:166968858-166968880 TTGAGTGTTGCAGCTTTTCTAGG - Intronic
983703799 4:170632176-170632198 CTGTCTATAGCTGTTTTTCTTGG + Intergenic
984138395 4:175971051-175971073 CAGGGAATTGCACCTTTTCTGGG - Intronic
984149674 4:176111186-176111208 CTGGGTATTTCCGTTTTTCTAGG + Intronic
984262663 4:177460839-177460861 CTGGCTGTTCCAAATTTTCTCGG + Intergenic
984636228 4:182112601-182112623 CTACTTAATGCAGCTTTTCTAGG + Intergenic
984772540 4:183450178-183450200 CTGCCAAGTGCAGCTTTTCTTGG + Intergenic
985083047 4:186285982-186286004 CTGGCTATTGAAACTTATTTTGG + Intronic
990513830 5:56514195-56514217 CTGGGAAGTGCAGTTTTTCTGGG - Intronic
992185309 5:74238871-74238893 CTGGCTGTGGCAGTTTTCCTGGG + Intergenic
992570959 5:78056926-78056948 TTGGCTATGGCAGCATTTGTTGG + Intronic
994635869 5:102343792-102343814 CTGGCTATTTCAGCCATTATTGG + Intergenic
997395109 5:133553424-133553446 CTTGCTACTGTAGCTTTGCTAGG - Intronic
997606730 5:135180229-135180251 CAGGCTTTTGCAGCTTAGCTGGG + Intronic
997671308 5:135675673-135675695 TTGGCTATTTAAGCTTTTATCGG + Intergenic
998167264 5:139851448-139851470 CAGGCCATTTCACCTTTTCTAGG + Intronic
999734444 5:154502205-154502227 CTGGTTCTTTCAGTTTTTCTTGG + Intergenic
1003238653 6:4322093-4322115 CTGGCTATTGGGGGTTTTTTAGG - Intergenic
1005419508 6:25634322-25634344 CTGGCCAGTGCAGCTCTTCCAGG + Intergenic
1005659945 6:27987234-27987256 ATGGCTGTTACAGCTTATCTGGG + Intergenic
1008340764 6:50361452-50361474 CTGGTTATTGCCTCTTTTTTTGG - Intergenic
1008731764 6:54491445-54491467 TTGGCTCTTACAGCGTTTCTGGG - Intergenic
1009703194 6:67210444-67210466 CTGGTTATTACAGCTATTTTAGG + Intergenic
1010674998 6:78732845-78732867 TTGGCTATTTCAGCTTTTTTTGG - Intergenic
1012560870 6:100579799-100579821 TTGGCTATTCCAGCTCTTTTTGG + Intronic
1012811995 6:103970732-103970754 CTGGCTATTTGGGCTTTTTTTGG - Intergenic
1015184952 6:130405128-130405150 TTGGCTATTGGAGCTCTTTTTGG + Intronic
1015255268 6:131172308-131172330 TTGGCTATTACATCTTTACTAGG + Intronic
1017174677 6:151492187-151492209 AGAGCTATGGCAGCTTTTCTTGG - Intergenic
1020584498 7:10049308-10049330 ATGGCTAGTGGTGCTTTTCTAGG - Intergenic
1021637110 7:22704295-22704317 GTGGCAAGTGCCGCTTTTCTAGG + Intergenic
1027122836 7:75534240-75534262 CTGTCTAGAGCAACTTTTCTTGG - Exonic
1027859468 7:83557941-83557963 CTGGGTTTTACAGCCTTTCTTGG - Intronic
1027980587 7:85215152-85215174 CTGGACATTTCAGATTTTCTTGG + Intergenic
1029060787 7:97795998-97796020 CTAGCTATTCCCACTTTTCTCGG + Intergenic
1030208858 7:106976848-106976870 CTGGCTAATGGATCATTTCTAGG - Intergenic
1030398517 7:109018930-109018952 CTGGCTCCTTCACCTTTTCTAGG + Intergenic
1032267083 7:130377276-130377298 CTGGCAATGGCAGTGTTTCTGGG + Intergenic
1032515256 7:132502080-132502102 CTGGCTTCTGCAGGTCTTCTTGG - Intronic
1037340730 8:17841675-17841697 CTTGCTTTTTCAGCTCTTCTAGG - Intergenic
1039289560 8:36079266-36079288 CTGTTTATTCCAGATTTTCTAGG - Intergenic
1040024039 8:42765248-42765270 CTGGCCACTGCAGCGATTCTAGG + Intronic
1042856692 8:73274445-73274467 CTGGCCATTTCATCTTTTTTAGG + Intergenic
1045116183 8:98983293-98983315 CTGGCTATTCAACCTTTTGTTGG + Intergenic
1045529328 8:102969809-102969831 GTGGCTACTGCAGACTTTCTGGG + Intronic
1046429999 8:114112724-114112746 TTGGCTATGGCAGCCTGTCTAGG + Intergenic
1050411633 9:5372469-5372491 CTGGCAATTACAGAATTTCTGGG + Intronic
1052585119 9:30417515-30417537 CTGTCTGTTTTAGCTTTTCTAGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1059180158 9:112204423-112204445 CTGGCTATTCAGGCTTTTTTAGG + Intergenic
1059859330 9:118440886-118440908 CTGGCTAGTGGAGGTTTTCAGGG - Intergenic
1061395828 9:130342857-130342879 CTGGCCAAAGCAGCTTTTCTGGG + Intronic
1062607777 9:137355735-137355757 CTGGATTTTGCAGTGTTTCTAGG - Intronic
1203370675 Un_KI270442v1:301535-301557 ATGGCTATTTCTGCTTTTTTTGG + Intergenic
1188014395 X:25092092-25092114 TTGGCTATTTGAGCTTTTTTTGG + Intergenic
1191031668 X:55980560-55980582 CTGAATATTGCACCTTTTCCTGG + Intergenic
1191033181 X:55997255-55997277 CTGGCTAATGATGCTTCTCTAGG - Intergenic
1191163603 X:57363046-57363068 TTGGCTATTCGGGCTTTTCTTGG + Intronic
1193435366 X:81468767-81468789 CTAGCTATTGCTGCCTCTCTAGG - Intergenic
1193949352 X:87778827-87778849 CTGGCTACAGCAGCTTTGCCAGG - Intergenic
1194208868 X:91044495-91044517 TTGGCTATTTGAGCTTTTTTGGG - Intergenic
1195170041 X:102258471-102258493 GTGTCTCTTGCAGCTTTTCTTGG + Intergenic
1195188816 X:102428629-102428651 GTGTCTCTTGCAGCTTTTCTTGG - Intronic
1197049606 X:122042677-122042699 CAGGCAATTGCCCCTTTTCTGGG + Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1198701848 X:139405476-139405498 CTGGCCATTTCAGCCTGTCTGGG + Intergenic
1201580592 Y:15507890-15507912 CTGTCTATTTTGGCTTTTCTTGG - Intergenic