ID: 1170160230

View in Genome Browser
Species Human (GRCh38)
Location 20:13303111-13303133
Sequence AAGGTTAGCTAACTTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170160226_1170160230 8 Left 1170160226 20:13303080-13303102 CCAGTCTATAGATAAGGAAAAGA No data
Right 1170160230 20:13303111-13303133 AAGGTTAGCTAACTTGTTCAAGG No data
1170160224_1170160230 23 Left 1170160224 20:13303065-13303087 CCGGCATTATTACATCCAGTCTA No data
Right 1170160230 20:13303111-13303133 AAGGTTAGCTAACTTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170160230 Original CRISPR AAGGTTAGCTAACTTGTTCA AGG Intergenic
No off target data available for this crispr