ID: 1170169317

View in Genome Browser
Species Human (GRCh38)
Location 20:13393465-13393487
Sequence GTGTCAGAGGGCCCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170169310_1170169317 12 Left 1170169310 20:13393430-13393452 CCAAATATGATGATATCAAGAAG 0: 1
1: 10
2: 29
3: 105
4: 515
Right 1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG No data
1170169309_1170169317 16 Left 1170169309 20:13393426-13393448 CCTGCCAAATATGATGATATCAA 0: 1
1: 12
2: 13
3: 22
4: 194
Right 1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG No data
1170169308_1170169317 29 Left 1170169308 20:13393413-13393435 CCGTCTGGAGAAACCTGCCAAAT No data
Right 1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170169317 Original CRISPR GTGTCAGAGGGCCCCCTCAA GGG Intronic