ID: 1170169689

View in Genome Browser
Species Human (GRCh38)
Location 20:13396707-13396729
Sequence AAATATCAACAGAATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 1, 1: 1, 2: 4, 3: 87, 4: 679}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170169686_1170169689 -1 Left 1170169686 20:13396685-13396707 CCGAGTTCAGCCAACCAATCAGA 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG 0: 1
1: 1
2: 4
3: 87
4: 679
1170169685_1170169689 0 Left 1170169685 20:13396684-13396706 CCCGAGTTCAGCCAACCAATCAG 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG 0: 1
1: 1
2: 4
3: 87
4: 679
1170169684_1170169689 24 Left 1170169684 20:13396660-13396682 CCAGAGCAATTTGAAGATACAAT 0: 1
1: 0
2: 3
3: 151
4: 1861
Right 1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG 0: 1
1: 1
2: 4
3: 87
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170169689 Original CRISPR AAATATCAACAGAATGAGAA AGG Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
902196965 1:14804941-14804963 AAATGTCAACAAAATGAACATGG - Intronic
902307211 1:15550699-15550721 AAATGTCAACACAGTGAAAAAGG - Intronic
902697813 1:18152059-18152081 ATATAGCAACAGAGGGAGAAAGG - Intronic
902741153 1:18439262-18439284 AAAAATCAAAAGATTCAGAAAGG - Intergenic
902953614 1:19908350-19908372 AAATAACATCAGAATCAGGAAGG - Exonic
903802652 1:25981268-25981290 AAATATCAAAATATTGAAAAAGG + Intronic
904099810 1:28015422-28015444 AAACATGAAAAGAAGGAGAATGG + Intronic
905094664 1:35459211-35459233 AAACTTGAACAGATTGAGAAGGG + Intronic
906015061 1:42569170-42569192 AACTATCATCAGAATGAACAGGG + Intronic
906342593 1:44993779-44993801 AAATATCAATATGATGAAAAAGG + Intergenic
908153437 1:61328374-61328396 AAATATCAAAAGCTTTAGAAAGG - Intronic
908587285 1:65583872-65583894 AAATATGAATATAATGAGACAGG + Intronic
909053578 1:70796645-70796667 AACTATCATCAGAATGAACAGGG - Intergenic
909362955 1:74786746-74786768 AAATATGAAAAGGATGAAAATGG - Intergenic
909509277 1:76432952-76432974 AGAAATCAACATAATGAGAATGG - Intronic
909711772 1:78659446-78659468 AAAGATCAAAAGAATTCGAAGGG + Exonic
909796954 1:79752151-79752173 AAATATTATCATAATGAGATAGG - Intergenic
909950271 1:81711730-81711752 AAATGTCAACAGAGTGAAAAAGG + Intronic
910110712 1:83680060-83680082 AATAATCAACAAAATGAAAAAGG - Intergenic
910628777 1:89336266-89336288 CATTATCAACAGCATGAAAATGG + Intergenic
911013452 1:93306277-93306299 AAAAATCAGCCTAATGAGAAAGG + Intergenic
911354428 1:96798408-96798430 AAATACAAAAAGAATTAGAAAGG + Intronic
912229812 1:107779612-107779634 AAAGATGTGCAGAATGAGAAGGG + Intronic
912969419 1:114266624-114266646 AAGTATCAGCAGCATGAAAATGG - Intergenic
913344208 1:117791885-117791907 TACTACCAACAGAGTGAGAAGGG - Intergenic
913367307 1:118054309-118054331 ACATATCAACACACTGAGAATGG - Intronic
913377055 1:118164011-118164033 GAATAAAGACAGAATGAGAACGG - Intronic
913472088 1:119198498-119198520 AAATAAAATCAGAATGAAAAAGG + Intergenic
914857110 1:151360748-151360770 AAACTTCTTCAGAATGAGAAAGG - Intergenic
915645074 1:157264745-157264767 AGAGATGAACAGAATGAGGACGG + Intergenic
916280280 1:163043903-163043925 AAATGTCAACAGAGTTAAAAAGG + Intergenic
916392979 1:164352686-164352708 AAATATTAGCAGAATGTAAAGGG + Intergenic
916875908 1:168968633-168968655 AATTATGAAAACAATGAGAAAGG - Intergenic
916883962 1:169049007-169049029 AAATATCAACAAGCTGAGAATGG - Intergenic
916898220 1:169190204-169190226 AAAAATCAACAGTAGGGGAATGG + Intronic
916963765 1:169914528-169914550 ACATATCTTCAGAATGAGGAAGG - Intergenic
917180004 1:172285779-172285801 AAATTTCAGAAGAATGAGAGTGG - Intronic
917670623 1:177270270-177270292 AAAAACCCACAGAGTGAGAAAGG - Intronic
917952901 1:180059291-180059313 AAATGTCAACACAGTGAAAAGGG - Intronic
918133422 1:181648127-181648149 AAATCTCCACAGATTGAGAGGGG + Intronic
918189778 1:182163073-182163095 AAATATTTACAAAATGTGAAGGG + Intergenic
918847210 1:189632339-189632361 AAATAGAAACAAAATAAGAAGGG - Intergenic
919253746 1:195095786-195095808 AAAAATCAACATAATTAAAATGG - Intergenic
919254131 1:195098736-195098758 GAATATAAACACAATTAGAAAGG - Intergenic
919443300 1:197667405-197667427 AAAAATAAAAAGAATGGGAATGG - Intronic
919596708 1:199573058-199573080 AAATATCGACAGAAATAGAGAGG + Intergenic
921126354 1:212181528-212181550 AAATGTTAAGAAAATGAGAAAGG - Intergenic
921211726 1:212906467-212906489 AAATGTCAACATAGTGAAAAAGG + Intergenic
921384719 1:214557174-214557196 AAACATCATCATTATGAGAAGGG - Intergenic
922454014 1:225759785-225759807 ATATATCAAAAGAATGACATTGG - Intergenic
922755604 1:228095061-228095083 AAAAACAAACAGAATGAAAAAGG - Intronic
923449276 1:234101284-234101306 AAATATTGACTGAGTGAGAAAGG - Intronic
1063160648 10:3415853-3415875 AAAAGTCAAGAGAAGGAGAAGGG - Intergenic
1063259148 10:4365242-4365264 AAATATTTACAAATTGAGAATGG + Intergenic
1063370518 10:5518939-5518961 AAATATCAACACAGTGAAAAGGG - Intergenic
1063634862 10:7772343-7772365 GAATATGAGCAGAATGAAAATGG + Intronic
1063748066 10:8908846-8908868 AAATATGGAAAGAATGAGGAAGG - Intergenic
1064236070 10:13576758-13576780 AAATGTCAACATAGTGAAAAGGG - Intergenic
1064525279 10:16249671-16249693 AAATAAAAACAGAACAAGAAAGG + Intergenic
1064751476 10:18534502-18534524 AAATATCAAAACAGTGAAAATGG - Intronic
1065083750 10:22153425-22153447 AACTATCAACAGAGTGGGAATGG + Intergenic
1065144265 10:22752045-22752067 AAAAATCAACAAAATGGGAAAGG - Intergenic
1065171071 10:23029845-23029867 AAAAACCTACAAAATGAGAATGG - Intronic
1066332811 10:34443391-34443413 ATTTATCAGCAGCATGAGAACGG - Intronic
1067131894 10:43572990-43573012 AAAGATCAACAGAATAAAAAAGG + Intronic
1067232616 10:44422732-44422754 AATTCTCAACAGAAAGAGGAGGG - Intergenic
1067274690 10:44823189-44823211 GGATATCATCAGAATGAAAAAGG - Intergenic
1067656132 10:48192998-48193020 AAATAGCAGCAGAAAAAGAAAGG - Intronic
1068228329 10:54136052-54136074 AAATATCTACAGTATTATAAAGG - Intronic
1068330742 10:55563764-55563786 AAATATCAATAGAGACAGAAAGG + Intronic
1068771173 10:60823284-60823306 AAATATCAACACAGTGAAAAAGG + Intergenic
1069091669 10:64206808-64206830 AAACATGAACAGAGTGAGAAAGG - Intergenic
1069121028 10:64569221-64569243 AAATATCAACAGAAAATGGAGGG + Intergenic
1069665996 10:70159190-70159212 AAATATCAAAATATTGACAAGGG - Intronic
1070183495 10:74037401-74037423 AAAGATCTACAGAAGCAGAAAGG - Intronic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1070362074 10:75700426-75700448 AAAAAAAAAAAGAATGAGAAAGG - Intronic
1070840405 10:79483263-79483285 AAATTACAACAAAATCAGAATGG + Intergenic
1071786704 10:88908857-88908879 AACTCTCAAGAGAAAGAGAAAGG - Intronic
1071939675 10:90575230-90575252 AAATATCATCAGCATGAAGAGGG - Intergenic
1071992437 10:91113048-91113070 AAATAACAACAAAATGAAGATGG - Intergenic
1072266645 10:93735459-93735481 ATATATAGACAGAATGGGAAGGG + Intergenic
1072343501 10:94479354-94479376 AAGTATTAACATAATGAAAAGGG + Intronic
1072476536 10:95766623-95766645 ATATATCAGCCAAATGAGAAGGG - Intronic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1073652190 10:105373030-105373052 AAATCTCAAAAGAATGATAGAGG + Intergenic
1073723102 10:106197612-106197634 AAAAAACAACAGAAGGAAAATGG - Intergenic
1073760265 10:106621543-106621565 AAATATCAAATGCATGTGAAGGG + Intronic
1074163087 10:110850218-110850240 GAATGTCAACACAGTGAGAAAGG - Intergenic
1074209402 10:111315927-111315949 AAATATCATCAGAAATAGACTGG + Intergenic
1074954212 10:118371691-118371713 AAATATAAACAGACTTTGAAGGG - Intergenic
1075528274 10:123203952-123203974 AAATATTGACAGAATGAGTAAGG + Intergenic
1075866371 10:125724095-125724117 AAAAAAGAAGAGAATGAGAATGG + Intronic
1076038126 10:127218679-127218701 AAATAACAACAGAAAGTGGAGGG - Intronic
1076773441 10:132679679-132679701 AAAAATCTACAAAATGAGACAGG + Intronic
1077767311 11:5173381-5173403 ATATAAAAACAGAATAAGAACGG - Intronic
1077781558 11:5335539-5335561 AAATATGAAAAGAATGAACAAGG - Intronic
1078393670 11:10958434-10958456 AAATAAGAACAGAATGCCAAGGG + Intergenic
1078923242 11:15850957-15850979 AAATCTAAACAGAGAGAGAAAGG - Intergenic
1078951529 11:16140284-16140306 GCATTTCAACTGAATGAGAAAGG + Intronic
1079306000 11:19322797-19322819 AAATATAAAGAGCATAAGAAGGG + Intergenic
1079527807 11:21411946-21411968 ACAAAGCAACAGGATGAGAAAGG - Intronic
1079786213 11:24676139-24676161 AAAAATCAACACAATGCTAATGG + Intronic
1079812530 11:25013196-25013218 ACAGATAAACAGAATGTGAAGGG + Intronic
1080141947 11:28932212-28932234 AAATATCAAGAGAATCAGCATGG - Intergenic
1080218672 11:29875352-29875374 AAACATCAAAAGGATGAAAAGGG - Intergenic
1080929863 11:36798600-36798622 AAAAATTAACATAATGAAAATGG + Intergenic
1081062154 11:38492954-38492976 AAATATCAAAAGAACTAGAAGGG - Intergenic
1081067089 11:38557258-38557280 TAATGTGAGCAGAATGAGAAAGG - Intergenic
1081124541 11:39306903-39306925 ACAAATCAACAGAATGGAAAAGG + Intergenic
1081889796 11:46531411-46531433 AAAGATTAACAGAATGAGGCTGG + Intronic
1082057056 11:47826897-47826919 AAATATCAACAAAGTGAAAAAGG - Intronic
1082658824 11:55885059-55885081 AAATAACAACTGAATGACTATGG - Intronic
1082674989 11:56087274-56087296 AAATATGAAAAAAATGAAAACGG + Intergenic
1082929115 11:58580129-58580151 ATTTCTCAAAAGAATGAGAAGGG - Intronic
1083173861 11:60937586-60937608 AAATATAAACACCATGAGAAAGG + Intronic
1083202831 11:61130866-61130888 TTACATCAACAGAGTGAGAAGGG + Exonic
1083786897 11:64955143-64955165 AAATATTAACACAGTGAGAAAGG - Intronic
1084397296 11:68920641-68920663 AAAAATCAAAAAAATGAGCAGGG - Intronic
1084452119 11:69245381-69245403 GAATATCTACTGAATGAGTAGGG - Intergenic
1084454526 11:69260402-69260424 AAATAGCTTCAGAAAGAGAAAGG - Intergenic
1084552407 11:69853265-69853287 AAATATTAAAAGAATAATAAGGG - Intergenic
1085087219 11:73677560-73677582 AAATCTCAACAGTATGAGTATGG - Exonic
1085212743 11:74795984-74796006 AAATATCAAAACAATGAAAAAGG - Intronic
1085879321 11:80446897-80446919 TAGTATCACCAGAGTGAGAATGG + Intergenic
1086384697 11:86295216-86295238 AAATTTCATCTGAATGAGAGTGG + Intergenic
1086630145 11:89007477-89007499 AAATAGCAGCAGAATGATAATGG - Intronic
1086876294 11:92099794-92099816 AATTCTCATCAGAATGAAAATGG - Intergenic
1087278592 11:96185018-96185040 AAATCTAAACAGTATGAGGAAGG - Intronic
1087919107 11:103846083-103846105 AAATATAAAGAGAATAAGAATGG - Intergenic
1087938637 11:104065528-104065550 AAATATAAATAAAATAAGAATGG + Intronic
1088241490 11:107777877-107777899 AAATCTCAATGGAATGGGAAAGG - Intergenic
1089040857 11:115448214-115448236 TAATCAAAACAGAATGAGAAAGG - Intronic
1089117350 11:116106657-116106679 AAATGTCAACACAGTGAAAAAGG + Intergenic
1089855599 11:121541611-121541633 AAATCTCAAAAACATGAGAAAGG + Intronic
1090043665 11:123312632-123312654 AAACATTTACAGAATGGGAAAGG - Intergenic
1090754339 11:129775843-129775865 AAATATATACAGACTGAGAAGGG + Intergenic
1090870339 11:130739008-130739030 AAATATCATCAGAATAACGAAGG - Intergenic
1090893343 11:130947445-130947467 CTATGTCAAGAGAATGAGAAGGG - Intergenic
1090983341 11:131743748-131743770 CAATTTCAAAAGAATAAGAATGG - Intronic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091032342 11:132202071-132202093 AAATAACGTCACAATGAGAAAGG - Intronic
1091121229 11:133059394-133059416 AAATATCAACACAGTGAAGAAGG - Intronic
1091181378 11:133607484-133607506 AAATAACAACAGAGAGAGAGAGG + Intergenic
1091593574 12:1859848-1859870 AAATAACAACAGCATCTGAAGGG + Intronic
1093288252 12:17293147-17293169 AAATATAAAAAGGAAGAGAAAGG - Intergenic
1093362025 12:18240922-18240944 AAATATCAACAAATTGAAAAAGG - Intronic
1093795697 12:23307845-23307867 AAATACCACCATAATGAGGAGGG - Intergenic
1093853102 12:24065140-24065162 AGATATCAGAAGAATGACAATGG + Intergenic
1094250679 12:28356710-28356732 AAATATTATCTGATTGAGAAAGG - Intronic
1094264216 12:28537577-28537599 AAATAACAACAGCATAAGCAAGG + Intronic
1094325822 12:29237306-29237328 AAATATCAACACAGTAAAAAAGG - Intronic
1095362301 12:41357516-41357538 AAAGATGAACACAATGAGCATGG + Intronic
1095958957 12:47821655-47821677 AGATTTCAACAGAAGGAGAAAGG - Intronic
1096269375 12:50152215-50152237 AAATGTCAACACAGTGAAAAAGG - Intronic
1096907822 12:54951470-54951492 AAGAATCAATAGAATGGGAAAGG - Intronic
1097138233 12:56877723-56877745 TGACATCAACACAATGAGAATGG - Intergenic
1097159298 12:57034990-57035012 AAAAATTAAAAAAATGAGAATGG + Intronic
1097209721 12:57357856-57357878 AAATGTTAACAGAATGAAAATGG - Intronic
1097362996 12:58679268-58679290 AAATATCAACATAAAGATACAGG - Intronic
1097462909 12:59885857-59885879 AAAAATCAACAAAATGAAAAGGG - Intergenic
1097992250 12:65848333-65848355 AAAAATTAACAGAAAGAAAATGG - Intronic
1097998439 12:65915574-65915596 AAATACCAATGGAATGAGAAAGG - Intronic
1098170146 12:67738485-67738507 ACTTATGAAGAGAATGAGAATGG + Intergenic
1098374147 12:69795364-69795386 AAGTATCAACAGAGTCAGAGGGG - Intronic
1098430542 12:70414765-70414787 AAATCTCAACAGTTTAAGAATGG - Intronic
1098713097 12:73792448-73792470 AAAAATCAACAGAGTGAAGAAGG - Intergenic
1098986725 12:77020279-77020301 ATTTATCAGCAGCATGAGAATGG - Intergenic
1099194931 12:79604421-79604443 AACTATCATGAGAATGAGATTGG + Intronic
1099323565 12:81181865-81181887 AAATAAAAAAAGAATGAAAAGGG + Intronic
1099402562 12:82217399-82217421 AAATATTGACAAAATGAAAAAGG - Intergenic
1099412837 12:82352396-82352418 AAATTGCAGAAGAATGAGAAAGG - Exonic
1099505950 12:83476215-83476237 AAATGTAAACAGAAAGAGACAGG - Intergenic
1099711581 12:86232608-86232630 AAACATGAACAGATTGAGAAGGG + Intronic
1100318132 12:93464574-93464596 AAAAATAAACAGAATTAGTAAGG - Intergenic
1100406537 12:94277006-94277028 AATTATCAACAGGATTATAAGGG + Intronic
1100851815 12:98719757-98719779 CAAGATCAAAAGAATGAGAAAGG - Intronic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101235796 12:102788116-102788138 AAATGTCAACACAGTGAAAAAGG - Intergenic
1101456250 12:104834431-104834453 AAGTATAAAGAGAATGATAAAGG - Intronic
1101482550 12:105113584-105113606 AAATTACAACCTAATGAGAAAGG + Intronic
1101499686 12:105291192-105291214 AAATATAAACAGAATTAGTCGGG - Intronic
1101627500 12:106459932-106459954 AAATATGAACCTAGTGAGAAGGG + Intronic
1101710215 12:107257769-107257791 AAAAGTCAACACAGTGAGAAAGG - Intergenic
1102826812 12:115953653-115953675 AAATCCCGAGAGAATGAGAACGG + Intergenic
1102840938 12:116120740-116120762 AAAGATCAAAAGAATTAGAAAGG - Intronic
1104121697 12:125806076-125806098 AAATATTTACAGAATGAGTGAGG - Intergenic
1104802819 12:131566311-131566333 TAAAATAAACAGAATGAAAATGG - Intergenic
1105747401 13:23391077-23391099 AAATACCAACACAAGGAAAAAGG + Intronic
1106397095 13:29391592-29391614 AAAGATCAAGAGTGTGAGAAAGG - Intronic
1106574704 13:30963816-30963838 AAATATCTATAGAATGAACAGGG - Intronic
1106709822 13:32318210-32318232 AAATGTCAACATCATGAAAAAGG + Intronic
1106864665 13:33950381-33950403 AAATATCGATATAATGAAAAAGG + Intronic
1107106652 13:36650366-36650388 AAATGTCAGCACAATGAAAAAGG - Intergenic
1107346981 13:39472427-39472449 AGACACCAAGAGAATGAGAAAGG - Intronic
1107680964 13:42849974-42849996 AAATGTCAACACAGTGAAAAGGG + Intergenic
1107916847 13:45161249-45161271 AAATATCAACACAGTGAAAAAGG + Intronic
1107949640 13:45450507-45450529 AAATATTTACAGAAGGAGAGTGG + Intergenic
1108147412 13:47493247-47493269 AAACATGAACACAATGAGGAGGG + Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108281691 13:48868079-48868101 AAATGGCGACAGAATTAGAATGG + Intergenic
1108398493 13:50013993-50014015 AATTATCACCAAAATGTGAATGG + Intronic
1108795126 13:54021584-54021606 AAAAGTCAACAGAATGATAAGGG - Intergenic
1109582900 13:64364956-64364978 AAATGACAACAGAATGAGTCCGG - Intergenic
1109644039 13:65229144-65229166 AAATGTAAACTGATTGAGAAGGG - Intergenic
1109812556 13:67533426-67533448 ATATATCAACAAAATGAGTGGGG + Intergenic
1110211060 13:72973868-72973890 AGATATCAACACAACAAGAAGGG - Intronic
1110485236 13:76032531-76032553 AGACATCAACAGAATGAAAAGGG - Intergenic
1110513934 13:76386322-76386344 AAATGGCAACAAAATGTGAAAGG + Intergenic
1110990323 13:82034598-82034620 AATCATCAACAGACAGAGAAGGG + Intergenic
1111089306 13:83421994-83422016 AAATATGTACAGAAAGAGAGAGG + Intergenic
1111341168 13:86888393-86888415 AGAAAACAACAGAATCAGAAAGG + Intergenic
1111683353 13:91470914-91470936 CAATAAAATCAGAATGAGAAAGG - Intronic
1112358107 13:98691605-98691627 AGATATCAACACAATAAGATTGG - Intronic
1112656891 13:101461132-101461154 AAGTTTCCCCAGAATGAGAAAGG + Intronic
1112731039 13:102362555-102362577 CAATATGAACAGAATGATATGGG + Intronic
1113718321 13:112530830-112530852 AAATATTAACAGAATGTGTCTGG + Intronic
1114038909 14:18658035-18658057 AAATCTCAACAGTATAAGTATGG - Intergenic
1114404471 14:22443184-22443206 AAATATCAACACAACGAAAAAGG - Intergenic
1114419433 14:22568856-22568878 AAAAATCAAAAGAATTAGAGGGG - Intronic
1114719294 14:24863033-24863055 AATTATCAACAGAATAAAGAAGG - Intronic
1115174344 14:30545409-30545431 AAATAGTAACAAAAGGAGAATGG - Intergenic
1116367116 14:44081335-44081357 AAATAACAACAGAATGCCCAGGG + Intergenic
1116693893 14:48148025-48148047 AAAAATCACCAGAAGGAGATAGG - Intergenic
1117116083 14:52514001-52514023 CAAAATCAGCAGAATGAGACAGG + Intronic
1118099899 14:62585977-62585999 AAAACTCAACAAACTGAGAAGGG - Intergenic
1118151609 14:63195976-63195998 ATTTATTAACAGCATGAGAAGGG + Intergenic
1118228041 14:63921406-63921428 AAATATCTAGAAAAAGAGAAGGG + Intronic
1119161922 14:72459808-72459830 ATATAGCAACAATATGAGAAAGG - Intronic
1119613190 14:76081007-76081029 AAAATTCAACAGAAAGAGACAGG - Intronic
1120115716 14:80615290-80615312 TAATATCCAGAGAATGATAAGGG + Intronic
1120526971 14:85588554-85588576 AAATAACCACATCATGAGAATGG + Intronic
1120549575 14:85853193-85853215 AACTGTCAACACAATGAAAAAGG + Intergenic
1120678771 14:87453810-87453832 AAAAACCAACAGTTTGAGAAGGG - Intergenic
1120825013 14:88946910-88946932 AGATATCAAAAGCATGAAAAAGG + Intergenic
1122222084 14:100246071-100246093 AAATATCAACAGCCTTAGAGAGG - Intronic
1122295479 14:100703402-100703424 AAATATCAGCAGGATGGGAGTGG + Intergenic
1123917763 15:25049430-25049452 AACAATCAACAGAATGAAAGAGG - Intergenic
1124713839 15:32039139-32039161 AAATAAGAAAAAAATGAGAAAGG - Intronic
1124785582 15:32676730-32676752 ACAAATCAACAGAGTGAGAGTGG + Intronic
1124886458 15:33691915-33691937 AATTATCAACACGATGAAAAAGG + Intronic
1126708809 15:51433406-51433428 ACATATCAACTGAAAGTGAAGGG - Intergenic
1127508841 15:59620526-59620548 CAATATAAACAAAATGAGGATGG - Exonic
1128184314 15:65631508-65631530 AGAGATCTGCAGAATGAGAAGGG + Intronic
1129563695 15:76597991-76598013 AACTATCAACAGAGTGAACAGGG + Intronic
1130504632 15:84527165-84527187 AAAAAAAAAAAGAATGAGAAAGG - Intergenic
1131016698 15:89063572-89063594 ACATATAAACACAAAGAGAAAGG + Intergenic
1131830290 15:96350374-96350396 AAAAATAAAAAGAATGAGAAGGG + Intergenic
1131842889 15:96456871-96456893 ACATTTCAAAAGACTGAGAAAGG + Intergenic
1133418782 16:5627599-5627621 AAATAACAACAAACTAAGAAGGG + Intergenic
1133540090 16:6742583-6742605 AAATATCTACAGTAGGTGAATGG + Intronic
1133776234 16:8897405-8897427 AACTCTCAGCACAATGAGAAAGG + Intronic
1135508879 16:23064384-23064406 AAATAGCAACAGTATGTAAAGGG - Exonic
1136034578 16:27529484-27529506 AAGTTACAACAGAATGATAATGG + Intronic
1136119310 16:28120482-28120504 AAATACCAAAATAAAGAGAAAGG + Intronic
1137090637 16:36185976-36185998 AATCATCAAATGAATGAGAATGG - Intergenic
1137217075 16:46405214-46405236 AATTATCAAAAGAAATAGAATGG + Intergenic
1137419896 16:48323817-48323839 AAATACCAACAGAAAGAAAAAGG + Intronic
1138107590 16:54297539-54297561 AAATATCAGCAGAAGTAGCATGG - Intergenic
1138830684 16:60370841-60370863 AAATATGTACAGAAAGACAATGG - Intergenic
1138894318 16:61184454-61184476 AAATATCATCAGAAAGAGGTAGG - Intergenic
1138949999 16:61900834-61900856 AAATATCAACAGGATTAGCTTGG + Intronic
1139062603 16:63271970-63271992 AAATATTAAAAGAAGTAGAAAGG - Intergenic
1139078248 16:63481909-63481931 AAATCTCAAGAAAATGTGAATGG + Intergenic
1139240014 16:65381578-65381600 AAACAACAACAAAAGGAGAAGGG + Intergenic
1139563636 16:67759248-67759270 GAGAAACAACAGAATGAGAAAGG + Intronic
1140658040 16:77160294-77160316 AAATTTACACATAATGAGAATGG + Intergenic
1140756245 16:78069951-78069973 AAATGTGAAGAGAGTGAGAATGG - Intergenic
1142909553 17:3076412-3076434 AAAAATCATCAGAATGAATAAGG - Intergenic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1145342748 17:21969204-21969226 GAATATCAACACAATTGGAATGG + Intergenic
1146113121 17:30110050-30110072 AAGTATCAAGATAATGACAATGG + Intergenic
1146363248 17:32196812-32196834 ACATTTCAACAGAATGAGGCAGG - Intronic
1146699364 17:34942319-34942341 AAATGTCAACACAATGTAAAAGG + Intronic
1147126401 17:38372190-38372212 AAATATCAAAAGAATTAAAAAGG + Intronic
1148709047 17:49663002-49663024 AAATATCAACATAATGAAAAAGG - Intronic
1149054342 17:52344633-52344655 AACTATCATCAGAGTGAAAAGGG - Intergenic
1149560540 17:57605061-57605083 AAATGGCAACAGAAGCAGAATGG - Intronic
1149880467 17:60285385-60285407 TAATAATAACAGAATGAAAATGG + Intronic
1151420634 17:73994860-73994882 AAAAATCAAGAGAAAGAGACTGG + Intergenic
1153205119 18:2690901-2690923 ATTTTTCAAAAGAATGAGAAGGG + Intronic
1153332859 18:3891576-3891598 AAATATCAAGTGAATAAAAATGG + Intronic
1153993277 18:10418720-10418742 AAATGTAAACACAATGAGAGAGG + Intergenic
1154972195 18:21421295-21421317 TAAAATCAACAGCATAAGAATGG + Intronic
1155375745 18:25155354-25155376 AAAAAGCAACAAAATGAAAAGGG - Intronic
1155548676 18:26941455-26941477 AAATATGGTCAGCATGAGAATGG - Intronic
1155803255 18:30135693-30135715 CAATATCAACATTATGACAAAGG - Intergenic
1156276618 18:35589498-35589520 AAACATTAACAGAAGCAGAAGGG - Intronic
1156686381 18:39652384-39652406 ATATATCAAAATAAAGAGAATGG + Intergenic
1157554014 18:48600883-48600905 AAATGTCACCAGTATGAGACAGG - Intronic
1158038080 18:53058925-53058947 ATTTATCAGCAGCATGAGAATGG - Intronic
1158433030 18:57408624-57408646 AAATATTAACATAATGAAATAGG + Intergenic
1159084047 18:63767411-63767433 AAATATCAACAGATTGATCTGGG - Intronic
1159089421 18:63831011-63831033 AAATAGCAAAAGAAAGAGATTGG + Intergenic
1159111841 18:64069008-64069030 AAATATCAACATAAAGACACAGG - Intergenic
1159357240 18:67352010-67352032 AAATATCCACAAAATTAGATAGG - Intergenic
1159377326 18:67609853-67609875 AAATTTCACCAGAAATAGAATGG - Intergenic
1159422421 18:68239797-68239819 TTATATCAACAGAATAAAAAAGG + Intergenic
1159484568 18:69038482-69038504 TAATATCAAAATTATGAGAATGG - Intronic
1159565502 18:70043390-70043412 CAATATTAGGAGAATGAGAAGGG + Intronic
1162650838 19:12087782-12087804 AAAAATCAACAGAAAGAAAAGGG - Intergenic
1164784045 19:30915306-30915328 AAATTAGAACAAAATGAGAATGG - Intergenic
1164928948 19:32158072-32158094 ATAAATAAACAGCATGAGAAAGG - Intergenic
1165650971 19:37489714-37489736 AAATATCAACAGAAACAGGATGG + Intergenic
1167856929 19:52249355-52249377 ATATTTCAAGATAATGAGAAGGG + Intergenic
1167958781 19:53089772-53089794 AGATATGTACAGAATGAGAGAGG - Intronic
926524725 2:13964744-13964766 AAATAACATCAGATTGAAAAAGG - Intergenic
926535912 2:14112026-14112048 AAAGATCAAAAGAATCAGCAAGG + Intergenic
926597287 2:14805142-14805164 AAATATCAGCACAATGTGACAGG + Intergenic
927549031 2:23980915-23980937 AAATATAAACAGGCTGAGCACGG - Intronic
927954098 2:27196037-27196059 AAATATCCATAGAGTGAAAATGG - Intergenic
928765690 2:34642501-34642523 AAACAGAAACAGAAAGAGAAAGG + Intergenic
929696699 2:44123143-44123165 TAATATCGACACAATGAAAAAGG + Intergenic
929983431 2:46701319-46701341 ATAGCTAAACAGAATGAGAATGG + Intronic
930028427 2:47043931-47043953 AAAGATGAAGAAAATGAGAAGGG + Intronic
930253444 2:49061328-49061350 AAATATAAACTGAAAGTGAAGGG + Intronic
930364941 2:50427820-50427842 AAATATAAAGAAAATGGGAATGG - Intronic
930422508 2:51171028-51171050 AAATCTGAACAGTATAAGAAGGG + Intergenic
930970833 2:57393533-57393555 AAATTTCAACAAAATAGGAATGG - Intergenic
931507696 2:62949791-62949813 TAATATCATCAGTAAGAGAAAGG - Intronic
931527714 2:63175823-63175845 AAATGTCAATAGATAGAGAATGG - Intronic
931896557 2:66737684-66737706 AAATATTACCAGAATGAGAAAGG + Intergenic
933044884 2:77523155-77523177 GAATATCCTCAGAATTAGAAGGG + Intronic
933406405 2:81865555-81865577 AAACATAAAAAGAATGATAAAGG + Intergenic
933657409 2:84900645-84900667 AAAGAGCAACAGAATGGCAAGGG + Intronic
933679049 2:85082532-85082554 AAATATAAATAGAAATAGAAAGG - Intergenic
934605238 2:95690064-95690086 GAACATCTACAGAATGGGAAGGG + Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935472057 2:103472280-103472302 AAAAATCAACATAGTGAAAATGG - Intergenic
936538689 2:113332603-113332625 GAACATCTACAGAATGGGAAGGG + Intergenic
936710985 2:115131034-115131056 AGATGGCTACAGAATGAGAAGGG - Intronic
937457621 2:122056060-122056082 AAATGTCAACATAGTGAAAAAGG - Intergenic
937513248 2:122622913-122622935 AACTACCAAAAGAATCAGAAAGG - Intergenic
937806776 2:126154168-126154190 AAATATCAACATCATGGAAATGG - Intergenic
938272047 2:129981046-129981068 AAATCTCAACAGTATGAGTATGG + Exonic
938443962 2:131362767-131362789 AAATCTCAACAGTATGAGTATGG - Intergenic
939542609 2:143512403-143512425 AAATGGCAGCAAAATGAGAAAGG + Intronic
939825040 2:147003944-147003966 AAATATGTACAGAATGATGATGG - Intergenic
940275613 2:151937485-151937507 AAATATAAATAAACTGAGAAGGG - Intronic
940749486 2:157610034-157610056 AAATATTAAGAGAAAAAGAAAGG - Intronic
941076131 2:161008456-161008478 AAATATCAGCACCATGAAAAAGG - Intergenic
941177798 2:162220989-162221011 AAATATTAAAAGAATGGGAAAGG - Intronic
941251385 2:163169054-163169076 TTTTATCCACAGAATGAGAAGGG - Intergenic
941488787 2:166117560-166117582 AAATGTCAACACAGTGAAAAAGG + Intronic
941519757 2:166525952-166525974 AAATGACAAAAGAATGATAAAGG + Intergenic
941533586 2:166696699-166696721 GAATATCAAGAGAAAGAGGATGG + Intergenic
941561465 2:167050693-167050715 AGTTATCAATAGAACGAGAAGGG + Intronic
941570087 2:167159864-167159886 AAATATCCAAAGAATAAAAAAGG + Intronic
941707780 2:168678165-168678187 AAATATCAACACAGTGACAAAGG + Intronic
942122687 2:172793843-172793865 AAATATGAACAGACTGGGCATGG + Intronic
942676219 2:178429146-178429168 AGATAACAGAAGAATGAGAATGG - Intergenic
942950259 2:181713311-181713333 CTTTATCAACAGAATGAAAATGG + Intergenic
943297383 2:186155204-186155226 AAATATCAACACAGTGAAAAAGG - Intergenic
943350490 2:186791472-186791494 AAAAAAAAAAAGAATGAGAAAGG + Intergenic
943432413 2:187820425-187820447 AAAAATCATCAGAATTAGAAGGG + Intergenic
943796659 2:192004965-192004987 AAATGTCAAAAGACTGAGATAGG - Intronic
944310569 2:198228742-198228764 AAAAATCTAGAGAATGACAAAGG + Intronic
944727546 2:202486326-202486348 AAATAGCAAAATAATGAGACAGG + Intronic
945504358 2:210620237-210620259 AAATATTCACAGACTGAGATGGG + Intronic
947084971 2:226441022-226441044 AAAACTCAACAGAATGCTAATGG + Intergenic
947699828 2:232223584-232223606 GTATAACAACAAAATGAGAAGGG + Intronic
947764216 2:232625731-232625753 AAATGTCAACACATTGAAAAAGG - Intronic
948019764 2:234720841-234720863 AAATGTCAACTCAGTGAGAAAGG - Intergenic
948226266 2:236311466-236311488 AAATGTGACCAGAATGAGATAGG - Intergenic
948778276 2:240301342-240301364 AATTACCAACAAAAAGAGAAGGG - Intergenic
949054372 2:241918380-241918402 AAAAATAAACACAATTAGAAAGG + Intergenic
1169118071 20:3079879-3079901 AAATTTATACAGAATGACAAAGG + Intergenic
1169390595 20:5187160-5187182 AAATGTCAACACATTGAAAAAGG - Intronic
1169643681 20:7784124-7784146 AAATATCAAAAGCATAATAAGGG - Intergenic
1169684984 20:8261113-8261135 AAAGATCAAGAGAAGCAGAAGGG - Intronic
1169993514 20:11529816-11529838 AAAGAACAACAGAATTAGGAAGG + Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1171515304 20:25727317-25727339 ACATATCAATAGAATGACACAGG - Intergenic
1173021655 20:39272536-39272558 AAATATTTACAGGAAGAGAAAGG + Intergenic
1173399652 20:42713259-42713281 AAAAATCAAAAGAAAGAAAAAGG - Intronic
1173675128 20:44827624-44827646 AATGATCAACAGACTGGGAAAGG - Intergenic
1175020387 20:55841529-55841551 AAAAATCAACAGAGTGAAAAAGG + Intergenic
1176521260 21:7826222-7826244 TAATAACAAAAGAATGAGAGGGG - Intronic
1177031791 21:15989350-15989372 AAATATCAAAAGATTAAGAATGG - Intergenic
1177223238 21:18220732-18220754 ATATCTCAGCAGAAAGAGAATGG - Intronic
1177265465 21:18777831-18777853 AAATATTAACACAGTGAAAAAGG + Intergenic
1177420885 21:20854879-20854901 AAAAAGCAACAGATTGAGAGTGG + Intergenic
1177725354 21:24960001-24960023 AACTACCAGCAGAATGGGAAAGG - Intergenic
1178249080 21:30984986-30985008 AAATATCAACAGAGTGGGGTTGG - Intergenic
1178655280 21:34456234-34456256 TAATAACAAAAGAATGAGAGGGG - Intergenic
1179325219 21:40335836-40335858 AAATGTCAACACCATGAGAAAGG - Intronic
1180173506 21:46074729-46074751 TAATATCAATTTAATGAGAAAGG + Intergenic
1182858651 22:33540116-33540138 AAATATTCATAGAAAGAGAAGGG - Intronic
1183125655 22:35778493-35778515 AAATATAAACAAAAGGAAAAGGG + Intronic
1183874727 22:40770001-40770023 AAAAATCACAAAAATGAGAAGGG - Exonic
1184085758 22:42262899-42262921 TAAAATCAACAGAATTAGCACGG + Intronic
1185120623 22:48967272-48967294 ACAGATCAACAGAATAAAAAAGG + Intergenic
1185364211 22:50428965-50428987 AAATATCTTCAGTATGATAAAGG - Intronic
949167466 3:959517-959539 ATATATAAACAGAATGGGGATGG + Intergenic
949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG + Intergenic
949658506 3:6249703-6249725 AAATATCAAAATAATTAGGATGG + Intergenic
950692433 3:14670769-14670791 AATTATCCAAAGAATAAGAATGG - Intronic
951284824 3:20797315-20797337 AAATATGGCCATAATGAGAAAGG - Intergenic
951372956 3:21874721-21874743 AAATTTCAAAAGAATCACAAAGG - Intronic
951421781 3:22494868-22494890 TTATATCAGCAGAATGAGACTGG - Intergenic
951440453 3:22717188-22717210 AAATATCTACATAATAATAAAGG - Intergenic
951758258 3:26116932-26116954 CAAAATCAACAGAAAGAAAAAGG - Intergenic
952478070 3:33731682-33731704 AAATGTCAACACAATGCAAATGG + Intergenic
952589904 3:34939155-34939177 AAATATTAAAAAAATAAGAATGG + Intergenic
952591249 3:34956837-34956859 AAAAATCATCAGAATCAAAATGG - Intergenic
953101470 3:39833343-39833365 AAATCACAAAAGAATGAGAGGGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953276433 3:41504166-41504188 AAATATCAACATAAAAAGAGAGG + Intronic
954014015 3:47669952-47669974 AAATGTCAACATAATGAAAAAGG - Intronic
954480794 3:50798396-50798418 CAATGACAAGAGAATGAGAAAGG + Intronic
955149328 3:56351344-56351366 AAATATGAAAAGAAAGAAAAAGG - Intronic
955893034 3:63670384-63670406 AAAGATTATCAGAATGGGAAGGG - Intronic
957251107 3:77772133-77772155 CTTTATCAACAGAATGAAAATGG - Intergenic
957292837 3:78299092-78299114 AAATTTCAGCTGAATGAAAAGGG - Intergenic
957563296 3:81853943-81853965 ATATATGCACAGAATGAGTAAGG + Intergenic
957866587 3:86032868-86032890 AAATCTGTAGAGAATGAGAAAGG - Intronic
959318989 3:104847413-104847435 ATATATCAGCAGCATGAAAATGG + Intergenic
959396092 3:105840278-105840300 ATACATAAACAGAGTGAGAAAGG + Intronic
959487413 3:106943103-106943125 AAATTTCAAAAGAATAAGACAGG - Intergenic
959666749 3:108931565-108931587 AAATCTTAACAGAAAGATAATGG - Intronic
959857198 3:111173604-111173626 AAACAACAATAGAAGGAGAAAGG - Intronic
960438402 3:117656065-117656087 AAATATCTTCAGAATGTAAAAGG + Intergenic
960768081 3:121160071-121160093 AAAAATGAACAGAATTACAAAGG - Intronic
961438756 3:126938100-126938122 ACAAATCAAGAGAATGAGTACGG - Intronic
961462163 3:127057766-127057788 AAATATGAACAGAAAGTCAAGGG - Intergenic
962649078 3:137470288-137470310 GAAGACCAACAGAATGAGACTGG + Intergenic
963071292 3:141307520-141307542 AACTATCAACAGAAAGGGAGCGG - Intergenic
963414320 3:144975189-144975211 AAAAACAAAGAGAATGAGAAGGG - Intergenic
963670829 3:148249696-148249718 AAATCTCAACAGCAAAAGAATGG + Intergenic
963957826 3:151274916-151274938 AAATATCCCTAGAGTGAGAAGGG + Intronic
964205370 3:154168676-154168698 ATACATCAACAGAAGGTGAAGGG - Intronic
964305173 3:155332062-155332084 AAATATCAACAGAATGGTACTGG - Intergenic
964435610 3:156649240-156649262 AAATATTAAAAGCATAAGAATGG + Intergenic
964504743 3:157386857-157386879 AAATGTCAACACAGTGAAAATGG + Intronic
964825303 3:160819887-160819909 AAATAACAATAAAATGACAAAGG - Intronic
964885512 3:161477565-161477587 AAATATCAAAAGGATGAAAGAGG - Intergenic
965428404 3:168556140-168556162 AAACAACAATAGAATGAGACAGG - Intergenic
967063820 3:185896301-185896323 AGTTAACAAGAGAATGAGAAAGG - Intergenic
967127942 3:186442634-186442656 AAATGTCAACAGGATGAAAAAGG - Intergenic
967293010 3:187940076-187940098 AAAAATGAGCAGACTGAGAAGGG + Intergenic
967560600 3:190913928-190913950 AAAAATCAACAAACTGAGCATGG - Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968828527 4:2917481-2917503 AACTATCATCAGAATGAAAAGGG - Intronic
969325000 4:6438283-6438305 AAACATTAACACACTGAGAAAGG - Intronic
970316073 4:14829455-14829477 TAATATCCACAGTATAAGAATGG - Intergenic
970365591 4:15354834-15354856 CAAAAACAACAGAATGGGAAGGG + Intronic
970398674 4:15697172-15697194 GAATATAAACAAAATGAAAAAGG + Intronic
970642508 4:18082770-18082792 AAATCTCAACAGATGGAGACAGG - Intergenic
971214811 4:24653008-24653030 AAATATTCTCAGAATGAGAAGGG + Intergenic
971219994 4:24696203-24696225 AAAAATTAAAAGAATGAGATAGG + Intergenic
971689574 4:29815454-29815476 AATTATTAACTGAATCAGAATGG + Intergenic
971917639 4:32893629-32893651 AAAAATAAACAGAATGACATTGG - Intergenic
971923669 4:32977557-32977579 AAATACCAACAAAACGAGGAAGG + Intergenic
971985481 4:33817300-33817322 AAATATTTACAGTATGAGAGAGG - Intergenic
972649003 4:40997673-40997695 AAATGTCAACACAGTGAAAAGGG - Intronic
972755171 4:42039245-42039267 AAATATACAGAGAATGAGCATGG - Intronic
973013104 4:45102219-45102241 AGAGATCACTAGAATGAGAAAGG + Intergenic
973136487 4:46714158-46714180 AACAATCAACAAAATGAAAAGGG - Intergenic
973558103 4:52106486-52106508 AAAGCTTAACAAAATGAGAATGG + Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974256312 4:59459434-59459456 AAATCTCAGCACACTGAGAAGGG + Intergenic
974256437 4:59461366-59461388 AAAAATAAAAATAATGAGAAAGG - Intergenic
974366217 4:60953202-60953224 AAAAATAAAAAGAATGGGAATGG - Intergenic
974581722 4:63812565-63812587 AAATATCAAAAAAAAGAAAAAGG - Intergenic
974815495 4:66998448-66998470 AAAGATGTACAGAGTGAGAAGGG + Intergenic
975018203 4:69451404-69451426 AAATATCATCTGAAATAGAATGG + Intergenic
975273810 4:72470663-72470685 GAATATCAACACAGTGAAAAAGG - Intronic
976101611 4:81569910-81569932 AAATGTCAAAACAATGAAAACGG + Intronic
976297418 4:83486050-83486072 AAAGATGAACAGAAGGAAAAGGG + Intronic
976730014 4:88252313-88252335 CTTTATCAACAGCATGAGAATGG - Intergenic
976827226 4:89274466-89274488 AAATATCAACATAGTCAAAAAGG - Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
977609463 4:99017310-99017332 AAATATCCAGAAAATGAGATAGG - Intronic
977650972 4:99469154-99469176 ATTTATCAGCAGCATGAGAATGG - Intergenic
978202679 4:106041246-106041268 AATTAATAACAGAATAAGAATGG + Intergenic
978339812 4:107710384-107710406 AAATAACAAAAGAATGATATGGG - Intronic
979223828 4:118262245-118262267 CAATATCAACACAATGACGAAGG - Intergenic
979303602 4:119115962-119115984 AAATATAAACAAAAAAAGAAAGG + Intergenic
979823154 4:125199494-125199516 AAATAGCAACAGACTGAAAATGG + Intergenic
979872292 4:125838761-125838783 AAATATAAATAAAATGAGTAAGG + Intergenic
980303807 4:131029925-131029947 AAAGATCATCAAAATGTGAAGGG + Intergenic
980456355 4:133048447-133048469 AAATATTAACCGAATGTAAATGG + Intergenic
980457417 4:133063417-133063439 TAATATCAATGTAATGAGAATGG - Intergenic
980759153 4:137205450-137205472 AACAATCAACAGAGTGAAAAGGG - Intergenic
981062482 4:140439924-140439946 CAAGAGCAACAGAGTGAGAATGG - Intergenic
981088374 4:140707263-140707285 AAATGTCACCACAATGGGAAAGG - Intronic
981419049 4:144527943-144527965 AAAAAACAAAAGACTGAGAAGGG + Intergenic
981629558 4:146803204-146803226 AAAAAAAAACAGCATGAGAATGG + Intronic
982026480 4:151257465-151257487 AAAAATGAACAGAGTTAGAAGGG - Intronic
982137353 4:152284410-152284432 AAATATAAATAGAATAAAAAAGG - Intergenic
982170148 4:152654075-152654097 AAAAACCATCAGGATGAGAAAGG + Intronic
982426037 4:155262009-155262031 AAAGATCAACAAAATGAAAAGGG - Intergenic
982452731 4:155572220-155572242 AAATATCAGAAGACTGAGAATGG + Intergenic
982680833 4:158427330-158427352 GAATATGAATAGAAGGAGAATGG - Intronic
982725814 4:158904586-158904608 AATTCTCAACTGAAGGAGAAAGG + Exonic
982793202 4:159616183-159616205 TAGTAGCAACAGAATGAGAAGGG - Intergenic
983298618 4:165897827-165897849 AAAAATCAACATCATGAAAATGG - Intronic
983597037 4:169481164-169481186 AAATAGCAAGAGAAGTAGAATGG - Intronic
983614122 4:169682870-169682892 AAATGTCAACACAGTGAAAAAGG + Intronic
983665224 4:170173872-170173894 AACAATCAACAAAATGAAAAAGG - Intergenic
983808381 4:172024068-172024090 AAACCTAAGCAGAATGAGAATGG - Intronic
983930332 4:173446263-173446285 AAACATCAACCAAATGAAAAAGG - Intergenic
984157350 4:176208581-176208603 AATTATCAACAGAGATAGAAAGG - Intergenic
985068765 4:186147551-186147573 ACATATCTACAGAATAATAATGG - Intronic
985336588 4:188904245-188904267 AAATATGAAGAGAGTGAGAGTGG + Intergenic
985676826 5:1235829-1235851 GAATATCACCAGAATAAAAAAGG - Intronic
986149857 5:5118260-5118282 AAATGGCAACAGAATAATAATGG - Intergenic
986246726 5:6014041-6014063 AAATGTCAACATAACGACAATGG + Intergenic
986580354 5:9259153-9259175 AGATAGCAAAAGAATTAGAATGG - Intronic
986979111 5:13426443-13426465 AAGTGTCAACAGAGTGAAAAGGG - Intergenic
987332535 5:16869891-16869913 TAATAAAAACAGAAGGAGAAAGG + Intronic
987609678 5:20186323-20186345 CACTATCAACAGAATGAAAAAGG + Intronic
988154262 5:27430085-27430107 AAATATCAACTGAATTAGACTGG - Intergenic
988249222 5:28733370-28733392 AATAATCAACAAAATGAAAAAGG + Intergenic
988377720 5:30458675-30458697 TAACATCAAAAGAATCAGAAAGG - Intergenic
988639884 5:33030068-33030090 CAATATCAATAGAATGTAAATGG - Intergenic
988960133 5:36362349-36362371 AAACATCAAAATAATGATAAGGG + Intergenic
989309925 5:40003302-40003324 AACAATCAACAAAATAAGAAGGG - Intergenic
989335042 5:40305960-40305982 AAATGCCAAAAGAATGAAAAGGG + Intergenic
989335843 5:40315969-40315991 GAATGTCAAAAGAATGACAAAGG + Intergenic
989443462 5:41500764-41500786 AATAATCAACAGAATGAAATAGG + Intronic
989489706 5:42036000-42036022 AAATGTCAACACAGTGAAAAAGG + Intergenic
989553972 5:42769644-42769666 GAATATCAACAGAATTTGAAAGG + Exonic
989692698 5:44163761-44163783 ACATATTAACAAAATGAAAATGG - Intergenic
989842533 5:46097566-46097588 TAAACACAACAGAATGAGAAAGG - Intergenic
990671220 5:58132232-58132254 CAAGATCAACGGAATTAGAATGG + Intergenic
990832450 5:59974817-59974839 TAATATGGAAAGAATGAGAATGG - Intronic
990880976 5:60538865-60538887 GAATATCAAAAGTAAGAGAAAGG - Intergenic
990992754 5:61701451-61701473 GAAGATCAAAAGAAGGAGAAGGG - Intronic
991096505 5:62745372-62745394 ATATAACAACAGTCTGAGAAGGG - Intergenic
991581487 5:68160125-68160147 AAATATCAACACAATGAGAAAGG + Intergenic
991662253 5:68962186-68962208 GAATATCAACCCAATGAGAATGG + Intergenic
992462872 5:76978784-76978806 AAATAACAACAAATTTAGAATGG + Intronic
992469138 5:77038434-77038456 AAATATTAGCACAATGAAAATGG - Intronic
992524643 5:77596775-77596797 AAATGTCAACACAGTGAAAAAGG + Intronic
992603497 5:78430423-78430445 AAATATGGAAAGAATCAGAAGGG - Intronic
993335032 5:86646469-86646491 AAGTATCAACAAAATGAAGAGGG + Intergenic
993430122 5:87822704-87822726 AAATATCAACAAAATTAGCTGGG - Intergenic
993472862 5:88327371-88327393 AACAATCAACAAAATGAAAAAGG - Intergenic
993478349 5:88392250-88392272 AAACATTAACTGAATGAAAACGG + Intergenic
994242524 5:97441673-97441695 AAAGATCAATAAAATGAGAATGG - Intergenic
994609933 5:102023208-102023230 AAATATCAATATCATGAAAATGG + Intergenic
995279810 5:110321070-110321092 AAATATAAGCAGAATGAGATTGG + Intronic
995356901 5:111248692-111248714 ATATATCATCACAATAAGAAGGG - Intronic
995419134 5:111943390-111943412 AAATGTGTATAGAATGAGAAAGG - Intronic
995971102 5:117972841-117972863 AAATTATAACAGAATGTGAAGGG + Intergenic
996187529 5:120496511-120496533 AGATATCTAAACAATGAGAAGGG - Intronic
996597930 5:125226695-125226717 AAATGTCAACTGCATGAGGATGG - Intergenic
996793222 5:127315800-127315822 AAATATAGACAGAAAGAAAAAGG - Intronic
996827432 5:127701198-127701220 AAATATCAGTAGGATCAGAAAGG - Intergenic
997705478 5:135947855-135947877 AAATATCAAAAGAATTAAAAAGG + Intronic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
998001004 5:138625943-138625965 AAATGTCAACACAATGAAAAAGG + Intronic
998676944 5:144420110-144420132 AAATATAAACACCATGAGGAAGG - Intronic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
999943569 5:156571013-156571035 AAAGATGAAAAGAAAGAGAATGG - Intronic
1000588725 5:163132089-163132111 AAAAAAAAAAAGAATGAGAAAGG - Intergenic
1000680382 5:164176514-164176536 AAAAAACAACAAAATGTGAAAGG + Intergenic
1001267312 5:170283268-170283290 AATTATCAACACATTGCGAATGG - Intronic
1001847474 5:174934995-174935017 AAATAAAAAAAGAATGAGAGGGG - Intergenic
1002472745 5:179446876-179446898 AAATGTCAACATGATGAAAAGGG + Intergenic
1002481476 5:179503786-179503808 AAATGTCAACATGATGAAAAGGG - Intergenic
1003243245 6:4362590-4362612 AATTACCAGCAGGATGAGAAAGG - Intergenic
1003593044 6:7451873-7451895 AAATACAAACAAAATGAGTAGGG - Intergenic
1003620557 6:7695701-7695723 AAATATTTTAAGAATGAGAAGGG - Intergenic
1003856104 6:10277263-10277285 AAATATCAAAAGTATAAGAAGGG + Intergenic
1004649185 6:17592135-17592157 AAGAATCAAAAGAATGAGAGAGG + Intergenic
1004807290 6:19217485-19217507 CAATATCGACATAATGAGATAGG - Intergenic
1004810931 6:19261716-19261738 AAATACCAAAAGATTGATAATGG + Intergenic
1005457049 6:26030826-26030848 CAAGATCAACAGAAAGAAAATGG + Intergenic
1005495266 6:26382828-26382850 AAAGAAAAAGAGAATGAGAAAGG + Intergenic
1006315642 6:33289899-33289921 AAATATCAACAGCTACAGAAGGG + Exonic
1007058284 6:38911049-38911071 AAATATCACTTGAATGAAAATGG + Intronic
1007811875 6:44492055-44492077 AAATTTTAACAAAATGTGAAGGG - Intergenic
1008128155 6:47691452-47691474 AGAAATCAACAGAGAGAGAATGG - Intronic
1008783330 6:55135111-55135133 AAATGGCAACAGAAAGTGAATGG + Intronic
1008810690 6:55494037-55494059 TCATATCTAAAGAATGAGAAGGG - Intronic
1009010191 6:57833171-57833193 AAATAAAGACAGAAAGAGAAAGG + Intergenic
1009517707 6:64641081-64641103 CATTATCAACAGAATGAAAATGG - Intronic
1009654870 6:66529569-66529591 GAATATCAAGAAAATGATAAAGG + Intergenic
1009797462 6:68490126-68490148 AAATATAAACAGAGAGAGATAGG - Intergenic
1010336889 6:74695791-74695813 AAACCTCAACAGTATGAGATAGG - Intergenic
1010484198 6:76390372-76390394 CAGTAACAACAGAATAAGAATGG - Intergenic
1010512616 6:76739168-76739190 AACAATCAACAGATTGAAAAGGG + Intergenic
1010793903 6:80096964-80096986 CCATATCAACAGACTGAAAAAGG - Intergenic
1011109126 6:83817548-83817570 AAAGTCCAACAGACTGAGAATGG - Intergenic
1012576519 6:100807531-100807553 AAATGTCACCAGAATGAGAAAGG - Intronic
1012862150 6:104572800-104572822 AAATATGAACATATTGAGAAAGG + Intergenic
1013172798 6:107652377-107652399 AAATAGCAAGAGAATTACAAGGG + Intronic
1013316194 6:108945616-108945638 AAGTCTAAACAGAATGAGAGAGG - Intronic
1013404952 6:109834830-109834852 AAATGTCAACACAATGAAAAAGG + Intergenic
1013639917 6:112064139-112064161 AAATACCAACACAGTGAAAAAGG + Intronic
1013666945 6:112358967-112358989 AAATCTCACCAAAATGAAAATGG - Intergenic
1014023128 6:116614055-116614077 AAACATTAAAAGGATGAGAAGGG + Intergenic
1014302865 6:119705477-119705499 AAATTAAAAGAGAATGAGAAGGG - Intergenic
1014621534 6:123673907-123673929 CTATATCAACAGCATGAAAATGG - Intergenic
1015208918 6:130673031-130673053 AAATGTCAACACAGTGAAAAAGG - Intergenic
1016067887 6:139702641-139702663 AAATATCAATGTAATTAGAAAGG + Intergenic
1016475006 6:144417968-144417990 AAATATCAACAATATCTGAAAGG - Intronic
1016693777 6:146968814-146968836 AAATAGCCACAGTTTGAGAATGG + Intergenic
1016793513 6:148092145-148092167 AAATAGCAAGAGAAGAAGAAAGG + Intergenic
1016900713 6:149097959-149097981 AGATATCAACAGAAAGACACAGG + Intergenic
1017191277 6:151655398-151655420 AAATATCCACAGAGTGACAAAGG + Intergenic
1017520370 6:155196421-155196443 AATTAGCAACAGAAAGAGAAAGG + Intronic
1017520389 6:155196612-155196634 AATTAGCAACATAAAGAGAAAGG + Intronic
1017562736 6:155647656-155647678 AACATTAAACAGAATGAGAAAGG + Intergenic
1017622438 6:156313299-156313321 AAATGTCAAAAAAATGAAAAGGG + Intergenic
1017631406 6:156399451-156399473 AAATATCAACACAATGAAGAAGG - Intergenic
1017749501 6:157478017-157478039 ATATATTAACTGAATGACAAAGG - Intronic
1017867672 6:158458156-158458178 AAATTTTAACAGAAAAAGAAAGG - Intronic
1017990768 6:159487898-159487920 AAATATCAATGGTAAGAGAAAGG + Intergenic
1018621791 6:165735738-165735760 ATATTTAAACAGAATGAGTACGG - Intronic
1018877413 6:167835723-167835745 AAATTCCAACAAAATGAGAAAGG + Intronic
1019138931 6:169931029-169931051 AGATCCCAAGAGAATGAGAATGG + Intergenic
1019772949 7:2895124-2895146 AAAAAAAAAAAGAATGAGAAGGG - Intergenic
1020509459 7:9035174-9035196 TGATAAGAACAGAATGAGAAAGG + Intergenic
1020617094 7:10472856-10472878 AAATAGCAACAGAACAAGAATGG + Intergenic
1020795014 7:12668408-12668430 GATTATCTACAGAGTGAGAAAGG + Intergenic
1020822752 7:12990625-12990647 AAATAGAAAGATAATGAGAAGGG + Intergenic
1021168666 7:17371466-17371488 AAATATCAGCTGAGTGTGAATGG - Intergenic
1021174143 7:17430735-17430757 AAACGTCAACACAATGAAAAAGG + Intergenic
1021186792 7:17574288-17574310 AAAAATCAAAAGACAGAGAAAGG + Intergenic
1021371188 7:19849558-19849580 AATTTTCAACAGTATGACAATGG - Intergenic
1022365871 7:29715622-29715644 AAATAAAAACAGATTCAGAAAGG - Intergenic
1022611933 7:31884605-31884627 AAAGCTCAACAGAATTTGAAAGG - Intronic
1022695025 7:32696625-32696647 AAATACAAACAGATTCAGAAAGG + Intergenic
1022939652 7:35221312-35221334 AAATATCAAAAGAAAAAGAAAGG + Intronic
1022989050 7:35689928-35689950 ATATAGTAAGAGAATGAGAAAGG + Intronic
1023165664 7:37341160-37341182 AAAGCTCCACAGATTGAGAAGGG + Intronic
1023672310 7:42590539-42590561 AAAAATCAACATCATGAAAATGG - Intergenic
1023948414 7:44821952-44821974 AATTATCACCAGAGTAAGAAAGG - Intronic
1024406400 7:48986658-48986680 AAAAATCAACATAATTAAAATGG - Intergenic
1024682027 7:51700668-51700690 AAATATAAAGAGAAGGAGAAAGG + Intergenic
1024735930 7:52303706-52303728 AAATGACCACAGGATGAGAATGG - Intergenic
1026199895 7:68205638-68205660 ACTTATGAACAGAATGAGGACGG - Intergenic
1026442795 7:70458650-70458672 AAACATCAACAAAGGGAGAAGGG - Intronic
1027801868 7:82763312-82763334 AAATATCAACCAAGTGAAAAAGG + Intronic
1028178582 7:87687213-87687235 AAAAATCAAAAGACTGATAAGGG - Intronic
1028916580 7:96266148-96266170 AAATATCAACATGGTGAAAAAGG + Intronic
1029936569 7:104431303-104431325 AAAAATGAATAGAATAAGAATGG - Intronic
1030130905 7:106198965-106198987 ACATATCAACAGAATGTGGTAGG - Intergenic
1030338684 7:108352659-108352681 AAATATCAACAGAATAATGGTGG + Intronic
1030885500 7:114931547-114931569 ATTTCTCAACAGGATGAGAAAGG + Intronic
1030967220 7:116007058-116007080 AATTACCAGCAGCATGAGAACGG + Intronic
1031322777 7:120353785-120353807 AAATATCAATAGAATGAAAAAGG - Intronic
1031494357 7:122428201-122428223 AAATGTCAACAGGATGTAAAAGG - Intronic
1031875881 7:127140543-127140565 TAACAGCACCAGAATGAGAAGGG - Intronic
1033185282 7:139221912-139221934 AAAAAACAACAGACTAAGAAAGG - Intergenic
1033719112 7:144038075-144038097 AAATATAAAACTAATGAGAAAGG - Intergenic
1034755070 7:153609002-153609024 AAATATCAACTAAATCAGATTGG - Intergenic
1035192702 7:157185776-157185798 AAAGTACATCAGAATGAGAAAGG - Intronic
1035867398 8:3099746-3099768 AAATATGAAAGGAATAAGAATGG - Intronic
1036421399 8:8599290-8599312 AAATAACAAAAAAATGAAAAAGG + Intergenic
1036624407 8:10455157-10455179 AAGTATAAACAGACTCAGAAAGG - Intergenic
1036624832 8:10461248-10461270 AAATATCAACAAAATTAAAAAGG + Intergenic
1038231165 8:25701826-25701848 AATGACCAACAGAATGAGAAAGG + Intergenic
1038296739 8:26298771-26298793 AAATAACAAAAGGATGGGAAAGG - Intronic
1038497735 8:28016001-28016023 AAATATCAAAAGAAAGTGATGGG + Intergenic
1038630772 8:29241570-29241592 AAATGTCAACACAGTGAGAAAGG - Intronic
1038654126 8:29433082-29433104 ATATTTCAACAGAATGGGAGTGG - Intergenic
1039126963 8:34214632-34214654 AAATATCAAATGAATAAGTATGG - Intergenic
1039487473 8:37922293-37922315 AAATGACAAGAGAATGAAAATGG - Intergenic
1039619724 8:38985476-38985498 AAAAATAAAAACAATGAGAAAGG - Intronic
1039668845 8:39572087-39572109 AAGTATCAAGAGAATTAGAGAGG - Intergenic
1039812266 8:41059693-41059715 AAATGTCAACAAAGTGAAAAAGG - Intergenic
1040507240 8:48059884-48059906 AAAGAGCAACAGAATGGGGATGG - Intronic
1040592718 8:48809392-48809414 AACAAACAACAGAATGATAATGG + Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1041698099 8:60759006-60759028 AAATGTCAACACAGTGAAAAGGG + Intronic
1041779464 8:61561470-61561492 AAATATAAAAATTATGAGAAAGG + Intronic
1041820269 8:62023969-62023991 ACATATCAAGAGAATGTGATTGG + Intergenic
1042330217 8:67572138-67572160 AAATCTGAACAGACTGATAATGG + Intronic
1042510762 8:69608699-69608721 AAATATAAAAAGAATAAAAATGG + Intronic
1042805709 8:72768847-72768869 AATTTTCAAAAGAATGAGGAGGG - Intronic
1042836885 8:73087105-73087127 AAACACCAACAGAGTGAGCAAGG - Intronic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043201654 8:77376909-77376931 AAATATCAAGACAATGAAATAGG + Intergenic
1043967711 8:86497754-86497776 AAACATAATCAGAATGACAATGG + Intronic
1044331942 8:90930736-90930758 ACATATCAATAAAATAAGAAAGG - Intronic
1044702312 8:94975821-94975843 TTATATCCACAAAATGAGAATGG - Intronic
1045133862 8:99190866-99190888 AAATGTGAAGAGAATGGGAATGG - Intronic
1045597301 8:103670956-103670978 CATTATCAACAGCATGAAAATGG - Intronic
1045699139 8:104846528-104846550 AAAGACAAACAGAATGACAAAGG - Intronic
1046164309 8:110410082-110410104 TCATCTCAATAGAATGAGAAAGG - Intergenic
1046214271 8:111122520-111122542 AAAGATAAACAGAAAGAGCAAGG + Intergenic
1046462136 8:114553335-114553357 AAATATCAGCAGTAAAAGAATGG + Intergenic
1046640011 8:116719216-116719238 AAATATCAACTGCATAATAATGG + Intronic
1046795492 8:118366915-118366937 AAAAATGAACAAAATGAAAAGGG + Intronic
1046813749 8:118561382-118561404 AAATATAAAGAAAATGATAAAGG - Intronic
1047061969 8:121237092-121237114 AAAGAAGAAAAGAATGAGAAAGG - Intergenic
1047123408 8:121931796-121931818 AAACAGCAAGAAAATGAGAAAGG + Intergenic
1047932715 8:129746957-129746979 AAATTTAAACAGACTGGGAACGG + Intergenic
1050193719 9:3057686-3057708 AAAAATTAAAAGAATGAGACTGG - Intergenic
1050900712 9:10945387-10945409 AAATATGATAAGAAAGAGAAAGG + Intergenic
1051029273 9:12655465-12655487 AAAAATAAACAGAAAAAGAAAGG - Intergenic
1051221500 9:14852979-14853001 GAATATAAAAAGATTGAGAAAGG + Intronic
1051294341 9:15579298-15579320 AATAATCAACAGAATCACAAAGG + Intronic
1051294552 9:15581971-15581993 AACTATCATCAGAATGAACAGGG + Intronic
1051802132 9:20947007-20947029 AAATGTCCACAGAATGAGACAGG - Intronic
1051817407 9:21124915-21124937 AAATTTCTACAGAATGTAAATGG + Intergenic
1052120715 9:24713278-24713300 CAATGTTAACAAAATGAGAAAGG - Intergenic
1052347273 9:27422432-27422454 CTATATCAACAGAATTAGAGAGG - Intronic
1052766543 9:32647103-32647125 ATAAAACATCAGAATGAGAAAGG - Intergenic
1053334703 9:37256394-37256416 AAATGTCAACACATTGAAAAAGG - Intronic
1053386980 9:37700047-37700069 AAAGGTCAACAGAATTAGAAAGG - Intronic
1053585878 9:39458182-39458204 AAATAATAACAGAATCAGGAGGG + Intergenic
1054580428 9:66907040-66907062 AAATAATAACAGAATCAGGAGGG - Intronic
1055282288 9:74688631-74688653 AAATGACAACAAAATGTGAATGG + Exonic
1057375642 9:94519909-94519931 AACTATCATCAGAATGAACAGGG - Intergenic
1058231077 9:102426334-102426356 AAACATAAACAGAAGTAGAAAGG + Intergenic
1058273579 9:103008406-103008428 AAAATTCAACAGCATAAGAATGG - Intronic
1058788942 9:108422231-108422253 AAATATCAATAAAATCAAAATGG + Intergenic
1058840004 9:108897053-108897075 GAAGAACACCAGAATGAGAAAGG + Intronic
1059837084 9:118167516-118167538 ATATATCCCCAGAATGAAAAAGG - Intergenic
1060556758 9:124511964-124511986 AAATATGAACACAGAGAGAAAGG + Intergenic
1060574742 9:124680842-124680864 AAATGTCAACATAGTGAAAAAGG - Intronic
1062608278 9:137358580-137358602 AAATTTCAAGAGAATAAGAGGGG - Intronic
1062670953 9:137709126-137709148 AAATATCAGCACAGTGAAAAAGG + Intronic
1185469159 X:372324-372346 AAATATCAACAGAAAGAAGTGGG + Intronic
1185940981 X:4318674-4318696 AAATGTCAACCCAGTGAGAAAGG - Intergenic
1186257965 X:7743183-7743205 AAATTTCAGAAGAATGAGTAAGG + Intergenic
1186404986 X:9294054-9294076 CAATATCATCAGACTCAGAAGGG + Intergenic
1186791982 X:13008509-13008531 AAATGTAAACAGCAAGAGAAGGG - Intergenic
1186964034 X:14768258-14768280 AAAAATCAATATAATGAAAATGG - Intergenic
1186981215 X:14959678-14959700 AAATCTCAACAGAATGCAGAGGG - Intergenic
1187078201 X:15957588-15957610 AAATATTAATAGAATCAGACAGG + Intergenic
1187638627 X:21262074-21262096 AGAAAGCAAGAGAATGAGAAAGG - Intergenic
1188306138 X:28561761-28561783 AAACACCAACATAATAAGAAAGG + Intergenic
1188740836 X:33779165-33779187 AAATATTAAAAGAATAATAAAGG - Intergenic
1189587850 X:42478891-42478913 AAATATCAGACTAATGAGAAGGG + Intergenic
1189640441 X:43064165-43064187 AAATAACAACAGAGACAGAAAGG - Intergenic
1189983588 X:46533917-46533939 CTTTATCAACAGCATGAGAACGG - Intronic
1190620942 X:52286269-52286291 AAATATCAACCAAAGGACAATGG - Intergenic
1190688262 X:52892952-52892974 GGAAATCAACAGACTGAGAATGG - Intronic
1190697720 X:52962840-52962862 GGAAATCAACAGACTGAGAATGG + Intronic
1191163959 X:57367293-57367315 AAATGTCAACATAATGAAAAAGG - Intronic
1192084449 X:68082247-68082269 AAATATCAACAAAATAACAGAGG - Intronic
1192922877 X:75725596-75725618 AAAGAAAAACAGAATGACAAAGG - Intergenic
1193633061 X:83913212-83913234 AAATATTAACAAAATTAAAATGG + Intergenic
1194080493 X:89457245-89457267 AAATTTGAACAGAATTTGAAGGG - Intergenic
1194130163 X:90071950-90071972 AGATAACAACACAATAAGAATGG - Intergenic
1194362616 X:92972758-92972780 AAATATTGACAGAATGAAAAGGG - Intergenic
1194508145 X:94758885-94758907 AAAAAACAAAAGAATCAGAAAGG + Intergenic
1194932636 X:99906325-99906347 AAATACAAACAGAATAAGACAGG - Intergenic
1195527221 X:105905224-105905246 AAATTTAGAAAGAATGAGAAGGG - Intronic
1195833296 X:109084285-109084307 AACTATCATCAGAGTGAAAAGGG - Intergenic
1196249471 X:113443190-113443212 AAATATCAATGAAATGACAAAGG + Intergenic
1196260870 X:113579693-113579715 AAACAAGAACAGATTGAGAATGG + Intergenic
1196569565 X:117249501-117249523 ATATATCAAGGGAATGAGACTGG - Intergenic
1197002136 X:121451758-121451780 AAATGTCAACAGGATGAGTCCGG - Intergenic
1197782709 X:130173028-130173050 CAATACCAACAGAATGAATAAGG - Intronic
1198260203 X:134959030-134959052 AAATATATACAGAATGAGATGGG - Intergenic
1198501578 X:137254522-137254544 ATAAATAAACAGCATGAGAAAGG + Intergenic
1199212083 X:145224395-145224417 AACTCTCAACAAAATGTGAAGGG - Intergenic
1199332211 X:146575621-146575643 AAATAATAACAGAAAAAGAAAGG + Intergenic
1199394394 X:147317615-147317637 AAACAACAACAGCATGAGATTGG - Intergenic
1199567013 X:149226014-149226036 AAAAATCAACATCATGAAAATGG - Intergenic
1199895652 X:152125154-152125176 AAGAATGAACATAATGAGAATGG + Intergenic
1200433168 Y:3113307-3113329 AAATTTGAACAGAATTTGAAGGG - Intergenic
1200477906 Y:3664071-3664093 AGATAACAACACAATAAGAATGG - Intergenic
1200670870 Y:6088978-6089000 AAATATTGACAGAATGAAAAGGG - Intergenic
1200718236 Y:6574654-6574676 AATCATAAACAGAATGTGAAGGG - Intergenic
1200736625 Y:6805761-6805783 AAATATCAAAAGAAAGAAAAAGG + Intergenic
1200810661 Y:7481167-7481189 AACTATCACCAGAGTGAGCAGGG - Intergenic
1201487753 Y:14510210-14510232 AAATACCAGCAGAAGCAGAATGG + Intergenic
1202329095 Y:23726805-23726827 AATTAGCAGCAGTATGAGAATGG - Intergenic
1202344493 Y:23907051-23907073 GAATATCAACATAGTGATAATGG - Intergenic
1202526275 Y:25763032-25763054 GAATATCAACATAGTGATAATGG + Intergenic
1202541676 Y:25943249-25943271 AATTAGCAGCAGTATGAGAATGG + Intergenic