ID: 1170169921

View in Genome Browser
Species Human (GRCh38)
Location 20:13399181-13399203
Sequence TATAAGTTGGGGAAGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170169921_1170169925 -4 Left 1170169921 20:13399181-13399203 CCTGGTTGCTTCCCCAACTTATA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 1170169925 20:13399200-13399222 TATAAGTACAAAATTTCCCCAGG 0: 1
1: 0
2: 1
3: 131
4: 5389
1170169921_1170169930 29 Left 1170169921 20:13399181-13399203 CCTGGTTGCTTCCCCAACTTATA 0: 1
1: 0
2: 1
3: 11
4: 106
Right 1170169930 20:13399233-13399255 CCTGTCTGTGTTCACCTCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170169921 Original CRISPR TATAAGTTGGGGAAGCAACC AGG (reversed) Intronic
905950286 1:41945187-41945209 TATTAGTTGGGGAAGGAGTCAGG - Intronic
909718711 1:78740623-78740645 TATATGTTGTGGGAGGAACCTGG + Intergenic
910590928 1:88927550-88927572 TATTAGTTGGGGAAGGAGTCAGG - Intergenic
913695273 1:121318734-121318756 TATAAGTTGCTGAAGCATCTAGG + Intronic
914142291 1:144961326-144961348 TATAAGTTGCTGAAGCATCTAGG - Intronic
916071426 1:161172257-161172279 TATAAGATGGTGAAGCACCGAGG - Exonic
920482605 1:206337113-206337135 TATAAGTTGCTGAAGCATCTAGG + Intronic
921052110 1:211518129-211518151 TATAAGATGAGGAAGAAACATGG - Intergenic
922684797 1:227630781-227630803 TATTAGTTGGGGAAGGAGCCAGG + Intronic
1066074886 10:31864987-31865009 TAAAAGTTGGGGAAACAGCAGGG + Intronic
1070700564 10:78598742-78598764 GATAATTTGGAGGAGCAACCAGG - Intergenic
1071846593 10:89527109-89527131 TGTAATTTGGGGAAGCTAACTGG + Intronic
1072362101 10:94669590-94669612 TATAGCTTGGGGAAGCAATTTGG + Intergenic
1079933847 11:26594681-26594703 TATTAGTTGGGGAAGGAGCTGGG + Intronic
1085601867 11:77862592-77862614 TATTAGTTGGGGAAGCAGTTGGG + Intronic
1087185624 11:95190771-95190793 GAGAAGTTGGGGAAGAAACTGGG - Intronic
1092293972 12:7183576-7183598 TATTAGTTGGGGAAAGAGCCGGG - Intergenic
1092469556 12:8765745-8765767 TATTAGTTGGGGAAGAAGCTGGG + Intronic
1096037157 12:48482554-48482576 TGTAATTTGGGGAACCAAGCAGG + Exonic
1097377377 12:58856636-58856658 TATTAGTTGGGGAAGGAGTCGGG + Intergenic
1099605162 12:84794852-84794874 TATTAGTTGGGGAAGGAGCCAGG - Intergenic
1101588260 12:106103718-106103740 TATATGTTGTGGAAGGGACCCGG + Intronic
1103166848 12:118777738-118777760 TTTAAGTAGGGGAAGCAAATGGG + Intergenic
1103802940 12:123551244-123551266 TATTAGTTGGGGAAGGAGCCGGG - Intergenic
1108876576 13:55056732-55056754 TATTAGTTGGGGAAGGAGTCGGG - Intergenic
1109931652 13:69224578-69224600 TATTAGTTGGGGAAGGAGTCGGG - Intergenic
1110604600 13:77417530-77417552 TAAAATTTGGGTAAGAAACCTGG - Intergenic
1110935425 13:81281485-81281507 TATAATTAGGGGAAACAGCCAGG + Intergenic
1111382968 13:87483363-87483385 TATACGTTAGTGAAGCAACAGGG + Intergenic
1113305578 13:109074842-109074864 TACATGTTGGGGAAGGGACCTGG - Intronic
1113400104 13:109984012-109984034 TCTAATTTGAGGAAGCAAGCAGG + Intergenic
1114264107 14:21061359-21061381 AACAAGTGGGGGTAGCAACCTGG + Intronic
1114269826 14:21093874-21093896 TAGAATTTGGGGAAGAAATCTGG - Intronic
1125684833 15:41558259-41558281 TAGAAGCAGGGGAAGCAACCAGG + Intronic
1125988839 15:44084925-44084947 TACAATCTGGGGAAGCAATCTGG + Intronic
1126458244 15:48888193-48888215 GCTAAGCTGTGGAAGCAACCCGG + Intronic
1131070538 15:89462973-89462995 CATATGTTGGGGAACCAGCCAGG + Intergenic
1134039600 16:11058216-11058238 TAGGAGTTGGGGCAGGAACCAGG + Intronic
1135604710 16:23813433-23813455 TATAAGATGAGGGAGAAACCAGG - Intergenic
1140327517 16:74019430-74019452 TTTAAGTTGGTGGAGAAACCAGG + Intergenic
1140696101 16:77535749-77535771 TGTAAGTTGGGAGAGCACCCAGG - Intergenic
1149274194 17:55015734-55015756 TATTAGTTGGGGAAGGAGTCGGG + Intronic
1149357658 17:55859459-55859481 TTTAAATTGGGGAGGCAACTTGG + Intergenic
1155055715 18:22181094-22181116 TCTAAATTGGAGAAGAAACCAGG + Intronic
1156618192 18:38813816-38813838 TATATGTTGAGAAAGCAACATGG - Intergenic
1159643633 18:70891893-70891915 CATATGTTGTGGAAGGAACCTGG + Intergenic
1164057254 19:21632199-21632221 TATTAGTTGGGGAAGGAGTCGGG - Intergenic
1164862207 19:31570574-31570596 TATAAGCTGGGGAAGCATCCTGG + Intergenic
925540569 2:4962161-4962183 TTTTAGTGGGGGAAACAACCAGG - Intergenic
926803564 2:16683937-16683959 TAGGAGTTGAGGAAGCAGCCTGG - Intergenic
926864363 2:17341907-17341929 TATTAGTTGGGAAAGGAATCGGG - Intergenic
928519182 2:32071657-32071679 TAGAAGTTGGGGAGGCTTCCAGG + Intronic
930875508 2:56211033-56211055 CATAAGTTGGTAAAGCAGCCTGG - Intronic
933388131 2:81637254-81637276 CCAAAGTTGTGGAAGCAACCTGG + Intergenic
933906944 2:86903426-86903448 GAAAAGCTGTGGAAGCAACCTGG - Intergenic
934024533 2:87990226-87990248 GAAAAGCTGTGGAAGCAACCTGG + Intergenic
936365223 2:111848255-111848277 GAAAAGCTGTGGAAGCAACCTGG + Intronic
946166095 2:217864837-217864859 TATAAGTTGGGTTATCAAACTGG + Intronic
1169629219 20:7607666-7607688 TCTAAGGTGGGCATGCAACCTGG - Intergenic
1170169921 20:13399181-13399203 TATAAGTTGGGGAAGCAACCAGG - Intronic
1170436768 20:16338394-16338416 AAGGAATTGGGGAAGCAACCAGG - Intronic
1171317644 20:24209576-24209598 AAAAAGATGGGGTAGCAACCTGG - Intergenic
1179259231 21:39743611-39743633 TATTAGTTGGGGAAGGAGTCAGG + Intergenic
1184264653 22:43340603-43340625 TATAACCTGAGGAATCAACCTGG - Intronic
951200787 3:19873763-19873785 TATTAGTTGGGGAAGGAGTCGGG + Intergenic
951837772 3:27001942-27001964 TATTAGTTGGGGAAGGAGTCAGG - Intergenic
952922330 3:38294193-38294215 TATTAGTTGGGGAAGGAGTCGGG + Intronic
954096534 3:48333028-48333050 TATTAGTTGGGGAAGGAGCCGGG + Intergenic
955077835 3:55630586-55630608 AATGAGTTGGGCAAGAAACCAGG + Intronic
957167653 3:76695775-76695797 TATAACTTGGGCAAGTCACCTGG + Intronic
958553457 3:95644694-95644716 GATATGTTGGGGAAGGAATCTGG - Intergenic
958689590 3:97446464-97446486 TATGTTTTGGGGAAGCAACAAGG + Intronic
959359717 3:105373131-105373153 TATGAGTTGGGTTAGCAGCCAGG + Intronic
964953334 3:162324012-162324034 TATTAGTTGGGGAAGGAGTCGGG - Intergenic
974293204 4:59961282-59961304 TCTCAGTTGAGGAAGCTACCAGG - Intergenic
975501314 4:75088343-75088365 TATAAGAAGGAGAAGCAACAGGG - Intergenic
981850177 4:149219991-149220013 CCTAGGTTGGGGAAGCAACTTGG - Intergenic
982287782 4:153753243-153753265 TAGAAGTGGGGGATGCAACCGGG + Intronic
984505321 4:180610333-180610355 TATAAATTTGGGAAGATACCTGG + Intergenic
984723648 4:183000045-183000067 TATTAGTTGGGGAAGGAGTCGGG - Intergenic
985198774 4:187462313-187462335 TAAAATTTGGAGAAGCAGCCAGG + Intergenic
985983397 5:3490408-3490430 GAGAAGTTGGGGAAGCACACTGG + Intergenic
986051617 5:4095140-4095162 TAAAAGTTGGGTATGAAACCCGG - Intergenic
987960271 5:24797958-24797980 TAAAATTTGGGGGAGCAACAGGG - Intergenic
988924917 5:35980017-35980039 CATATGTTGTGGAAGAAACCTGG - Intronic
988957275 5:36332201-36332223 TATTAGTTGGGGAAGGAGTCAGG + Intergenic
994041380 5:95263459-95263481 TAGAATTTGTGGCAGCAACCTGG - Intronic
995465544 5:112446702-112446724 TATTAGTTGGGGAAGGAATCAGG - Intergenic
998127117 5:139632069-139632091 TAGAAGTTGGGAAAGGAACATGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001757356 5:174180823-174180845 TACAGGATGGGGAAGGAACCTGG - Intronic
1002272743 5:178083377-178083399 TAGATGCTGGGGAAGCAACTAGG - Intergenic
1002406025 5:179032321-179032343 GATAAGTTAGAGAAGCAACAAGG + Exonic
1009313326 6:62185769-62185791 TATAATTTGGATAAGCAAACAGG - Intronic
1011189879 6:84717577-84717599 TATTAGTTGGAGAAGGAGCCGGG + Intronic
1013543449 6:111133716-111133738 TATTAGTTGGGGAAGGAGTCAGG - Intronic
1013955035 6:115832014-115832036 TGTAAGTCGTGGAAGAAACCAGG + Intergenic
1016014903 6:139173573-139173595 TTTAACATGGGGAAGCACCCTGG + Intronic
1019792332 7:3024219-3024241 TATCAGTTGGGGAGGGAATCTGG - Intronic
1021957190 7:25837457-25837479 TATAAATTGTTGAAGCATCCTGG + Intergenic
1025710794 7:63906311-63906333 TCTAAGCTGGGGCAGCAACGCGG + Intergenic
1028588686 7:92474977-92474999 TATTAGTTGGGGAAGGAGTCGGG + Intronic
1030843590 7:114383425-114383447 TATTAGTTGGGGAAGGAGTCAGG + Intronic
1030979920 7:116174318-116174340 GATAAGCTGGGGAAGCCACAGGG - Intergenic
1037470419 8:19203201-19203223 TCTAAACTTGGGAAGCAACCAGG - Intergenic
1041663972 8:60424619-60424641 TATTAGTTGGGGAAGGAGCCAGG + Intergenic
1045714907 8:105030650-105030672 TATACCTTGGGGAAGCCACATGG + Intronic
1046441283 8:114258208-114258230 TCTAAAATGGGGAAGCAAACCGG + Intergenic
1052780347 9:32776511-32776533 AATAAGTTGGGGAAGCCAGCAGG - Intergenic
1052991382 9:34521134-34521156 TCTAGGCTGGGGAAGCAAACTGG - Exonic
1054283966 9:63147384-63147406 TTTAAGTTGGAGAAGCATCTTGG + Intergenic
1055867023 9:80827142-80827164 TAGTAGTTGTGGAAGTAACCTGG - Intergenic
1056114351 9:83427194-83427216 TATAGGCTTGGGAAGCAGCCAGG + Intronic
1057401309 9:94726080-94726102 CAAAAGCTGGGGAAACAACCAGG - Intergenic
1058570083 9:106332187-106332209 TATAAGAGGAGGAAGAAACCAGG - Intergenic
1059786882 9:117596147-117596169 TAGAAGTTGGGAAAGCAGCCAGG - Intergenic
1187540654 X:20190672-20190694 TATAAGTTGGGAAAATAATCAGG + Intronic
1189131131 X:38498948-38498970 GATGAATTGGGGAAGCAACCAGG - Intronic
1199449376 X:147962356-147962378 TATAAGATGGGGATTGAACCTGG + Intergenic