ID: 1170171692

View in Genome Browser
Species Human (GRCh38)
Location 20:13420878-13420900
Sequence AAATCTACTCAGTATAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170171691_1170171692 7 Left 1170171691 20:13420848-13420870 CCTGTGGTATTTCATTGTTATAT 0: 1
1: 0
2: 0
3: 25
4: 269
Right 1170171692 20:13420878-13420900 AAATCTACTCAGTATAGATAAGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170171692 Original CRISPR AAATCTACTCAGTATAGATA AGG Intronic
902897352 1:19487942-19487964 AAATGTCCTCAATATAGAAATGG - Intergenic
905045898 1:35000656-35000678 AAACCTACTCAGTATCAACATGG + Intronic
906576505 1:46895482-46895504 AAAGTTCCTCATTATAGATAGGG + Intergenic
906595413 1:47072103-47072125 AAAGTTCCTCATTATAGATAGGG - Intronic
908431063 1:64058407-64058429 AAATCTTTTCACTAAAGATAAGG - Intronic
911784682 1:101931622-101931644 GCATCTGCTCAGTATAGCTATGG - Intronic
917055761 1:170979372-170979394 AAATCAACTGACTATATATATGG - Intronic
919333351 1:196200493-196200515 AAATCTAATTAATAAAGATATGG - Intergenic
921069627 1:211648381-211648403 ATATCTACCCAGTCTAGTTATGG + Intergenic
923899529 1:238310656-238310678 AAATCAAAGCAGTACAGATATGG - Intergenic
1063055399 10:2498878-2498900 TAATCAAATCAGTATAGATTAGG - Intergenic
1063578404 10:7282561-7282583 AAAATTACTCAGGATAGAGATGG + Intronic
1064256030 10:13743419-13743441 CAAGCAACTCAGTGTAGATAGGG + Intronic
1064813000 10:19223050-19223072 ATATCAACTCACTATAGATTAGG + Intronic
1068465884 10:57390703-57390725 TGATATATTCAGTATAGATATGG - Intergenic
1068708877 10:60109627-60109649 AAATGTTTTCAGTATAAATATGG + Intronic
1071164834 10:82793521-82793543 AAATCTCCCCAGAATAAATAAGG - Intronic
1071670177 10:87601667-87601689 AAATTAACTCAAAATAGATAGGG - Intergenic
1072289948 10:93954981-93955003 AAACATACTCAGTATAGAAAAGG - Intronic
1072363279 10:94682064-94682086 AAACCTACTCAGTATAACTGAGG - Intergenic
1073622419 10:105062908-105062930 AAATCTACTCTGGTTATATAAGG + Intronic
1073932173 10:108588404-108588426 AAATCTAGTCAGTACATGTATGG + Intergenic
1074453593 10:113578809-113578831 AAATCAACTGAGCATAAATAAGG - Intronic
1075998997 10:126900692-126900714 AAAATTGCTCAGTCTAGATATGG - Intergenic
1084996741 11:72987233-72987255 AAATTTTCTAAGTAGAGATAAGG - Intronic
1088261801 11:107951030-107951052 ACATCTTGTCAGTATATATATGG + Intronic
1090516413 11:127432933-127432955 AAATGGACTCAGTATAGTTTAGG - Intergenic
1092529896 12:9335449-9335471 AAATCTACAGAGTATTGATCTGG - Intergenic
1097589449 12:61556262-61556284 AAAGCTACTCAATTTAGATTTGG + Intergenic
1098383974 12:69899020-69899042 AAATTTACTCAGCATAGTTTGGG + Intronic
1098485625 12:71018077-71018099 AAATCATCTCAGTTAAGATAGGG - Intergenic
1099476749 12:83117076-83117098 AAATCAACTCAACATGGATAAGG - Intronic
1100419997 12:94423706-94423728 ATTTCTACTCAGTAAAGATGGGG + Intronic
1101038512 12:100730110-100730132 AAATCTTATAAGTATAGATCAGG + Intronic
1101679390 12:106950210-106950232 GAATCTACTCAGCATATAAAAGG - Intergenic
1105060645 12:133147090-133147112 AAATCTACTCAGTAATAAAAAGG - Intronic
1105319154 13:19300768-19300790 AAATCTGCCTACTATAGATAGGG - Intergenic
1105738658 13:23298797-23298819 AAATCTTCTCACTGTATATACGG + Intronic
1107590653 13:41900781-41900803 AAATTTACTCAAAATAGCTACGG + Intronic
1109031118 13:57189648-57189670 TAATTTATTCAGTAGAGATAAGG + Intergenic
1109960796 13:69627068-69627090 TAATGTACTAAATATAGATATGG + Intergenic
1111072823 13:83190766-83190788 CAATCTACTCAGAATAGGTTTGG - Intergenic
1111697663 13:91645454-91645476 TAATCTCCTCAGTATAGATCAGG + Intronic
1112407359 13:99133097-99133119 TAATCAACTCAGTAAAGATTTGG - Intergenic
1115745554 14:36433416-36433438 AAATCTAGAGAGTATAGTTATGG + Intergenic
1116368766 14:44103821-44103843 AAAATTACTCAATATTGATAAGG - Intergenic
1120351173 14:83360544-83360566 GAAACTACTCAGAATAAATAAGG - Intergenic
1122260056 14:100512265-100512287 AAATCTACTTAGTAAATATAGGG + Intronic
1128624992 15:69191876-69191898 AAATCTACAAAGTACAGAAAAGG - Intronic
1131087106 15:89586274-89586296 AAATCTACCTAGCATAAATAAGG + Intronic
1132319052 15:100911411-100911433 AAATCTACGCAATAGAGATATGG + Intronic
1138798558 16:59998835-59998857 AAATGTAGTCTGTATATATAAGG + Intergenic
1140356306 16:74309829-74309851 GAATTGACTCAGTATAGACATGG + Intergenic
1141014201 16:80432982-80433004 AAATCATCTCAGTAAACATAGGG - Intergenic
1144799530 17:17915822-17915844 AAACCTACTCAGTTTAAAAATGG - Intronic
1149524497 17:57344255-57344277 AAATCTATTTCTTATAGATATGG + Intronic
1151280212 17:73068360-73068382 AAATCTAATCCTCATAGATATGG + Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1154399354 18:14020562-14020584 AAATTTACTCAATATGGAAATGG + Intergenic
1155503305 18:26508185-26508207 AAATCTATACAGGACAGATATGG - Intronic
1155733506 18:29192003-29192025 AAACGTACTCAGTATAAACATGG + Intergenic
1156571274 18:38256241-38256263 ATATCTACTGAGTATACATAGGG - Intergenic
1156854718 18:41768435-41768457 AAGCCCACTCAGTATTGATAGGG - Intergenic
1157268815 18:46253169-46253191 AAAGCATCTCAGTATAAATATGG + Intronic
1163171635 19:15535522-15535544 AAATCTGTTCAGTATATAGAAGG + Intronic
1164642857 19:29839187-29839209 AAATCTAATGATAATAGATAAGG - Intergenic
1166416531 19:42599017-42599039 AAATCAACTCAAGATTGATAAGG - Intronic
926652539 2:15362170-15362192 GAATCTTCTCAGAATAGATTGGG - Intronic
926774201 2:16406023-16406045 ATATCTACTCACTACAGTTAAGG + Intergenic
932895136 2:75632011-75632033 AATTCTACTCAGTATCGTTCAGG + Intergenic
934913245 2:98277883-98277905 AAATAAACTCAGAATATATACGG + Intronic
935615324 2:105073789-105073811 AAATCTACTCAATGGAGATTAGG - Intronic
935732978 2:106080015-106080037 AAATCTAGCAAGTATAGTTAAGG - Intergenic
938889241 2:135686162-135686184 AAAGCTATTAAGTATTGATAAGG + Intronic
939989228 2:148861737-148861759 AAATCTACTTAGGCTAGCTAAGG - Intergenic
941472457 2:165904968-165904990 AAATCAACACATAATAGATAGGG + Intronic
944055782 2:195520673-195520695 AAATATACCAAGTATAGAAAGGG + Intergenic
944092350 2:195926034-195926056 AAAACTACCCTATATAGATAAGG - Intronic
945397844 2:209342557-209342579 AAATCTACACAGCATAGGTGTGG + Intergenic
946292829 2:218758331-218758353 AAGCCTACTCAGAATAGTTATGG + Intergenic
946573252 2:221047309-221047331 AAATCTACTCTTTCTAGAAAAGG - Intergenic
947053360 2:226072432-226072454 ATATATACTGAGTATAAATATGG - Intergenic
1169809732 20:9597189-9597211 AAACCCTCTCAGTACAGATAAGG - Intronic
1169848611 20:10024838-10024860 AGATTTACTCTGTATATATATGG + Intronic
1170171692 20:13420878-13420900 AAATCTACTCAGTATAGATAAGG + Intronic
1170923713 20:20703323-20703345 AAATCTACTAAGAATCTATATGG + Intronic
1173698805 20:45048049-45048071 AAAGATGCTCAGTATATATAAGG + Intronic
1174895378 20:54443901-54443923 AAATCTACTGAATATACAAATGG - Intergenic
1175613903 20:60376085-60376107 AAATCAAATCAGTATAATTAGGG - Intergenic
1183894097 22:40953834-40953856 AAATCTACTCAATCTAAAGATGG + Intronic
949327104 3:2879102-2879124 AGATGTAATCAGTAAAGATAAGG + Intronic
949733982 3:7149230-7149252 AAGTCTACTCAGTTTTGGTATGG + Intronic
949766685 3:7534722-7534744 ATATATACTCTGTAAAGATAAGG - Intronic
950865552 3:16185924-16185946 AAATCTACTAAGTTTTGATAAGG - Intronic
951850734 3:27137562-27137584 CACTTTACTCAATATAGATATGG + Intronic
952195959 3:31075632-31075654 AAATCTCCTCAGTATCAAAATGG - Intergenic
954095729 3:48326196-48326218 AGATCTACTCTGGACAGATATGG - Intronic
957172921 3:76762501-76762523 AAATATACTCAGTATTTACATGG + Intronic
958528858 3:95297855-95297877 GGACCTACTCAGAATAGATAAGG - Intergenic
959680520 3:109090851-109090873 AATCCTACCCAGTAGAGATAAGG + Intronic
959711163 3:109387188-109387210 AAATGTACACAGTATAGAGAAGG + Intergenic
961708678 3:128809877-128809899 AAATCAACACAGTCCAGATAAGG - Intronic
962286506 3:134090700-134090722 AAATCTTCTCAGTGTTGATTTGG + Intronic
962881517 3:139581649-139581671 ATATCTACTTATTATAGATTAGG - Intronic
963370607 3:144395059-144395081 AAATATAATTAGTTTAGATAAGG - Intergenic
966332115 3:178826010-178826032 AAATATACTCATTATAAAAACGG + Intronic
969502411 4:7561140-7561162 AGTCCTACTCAGTATAGATCTGG + Intronic
971901328 4:32663063-32663085 TAATCTTCTAAGTATATATATGG - Intergenic
972008532 4:34143201-34143223 AAATGCTATCAGTATAGATATGG + Intergenic
974405168 4:61458460-61458482 AAATATACTAATTATATATATGG + Intronic
979634181 4:122938767-122938789 AAATCTTCTTAGTAGAGATGGGG + Intronic
979723905 4:123937250-123937272 AATGCTTCTCTGTATAGATAAGG - Intergenic
982052854 4:151520055-151520077 AAAACTTCTCATTAAAGATATGG - Intronic
984528621 4:180888091-180888113 AAAACAACACAGTATACATAGGG + Intergenic
984771618 4:183441652-183441674 AAATCTACTCAGAGGAGAAAAGG - Intergenic
987414021 5:17644055-17644077 AAATCAACTCAAGATGGATAAGG - Intergenic
988055816 5:26094354-26094376 ATATATATTCAGTATATATACGG - Intergenic
990585287 5:57205664-57205686 AAATATACTCAGTATCATTAGGG - Intronic
991400302 5:66244750-66244772 TAATCTTCTCAGTGTAGACAAGG - Intergenic
992151110 5:73904082-73904104 AAACTGAGTCAGTATAGATAAGG + Intronic
992769024 5:80030039-80030061 AAAACTACTTAGCACAGATAAGG - Intronic
993732823 5:91443170-91443192 AATTCTACCCACTATAGCTATGG - Intergenic
993770084 5:91916084-91916106 AAAACAAATGAGTATAGATAGGG + Intergenic
994107708 5:95964798-95964820 ATAGCTACTCAGTGTATATAAGG - Intergenic
994432401 5:99684162-99684184 GAATCTACTCAACATTGATAAGG + Intergenic
995401474 5:111747192-111747214 AAAACTAGTCAGTATTTATATGG - Intronic
995993364 5:118269519-118269541 AAATTTACCCAGTTTACATATGG - Intergenic
996721038 5:126630384-126630406 AAATCAACTCAGAATGGATTAGG - Intergenic
997065199 5:130551459-130551481 AAATCTATTCAGTAGAAATCAGG - Intergenic
997767706 5:136521927-136521949 AATTCTATTCAGTAATGATAAGG - Intergenic
998373376 5:141675226-141675248 GAATCTACTCAGGTTAGTTAAGG - Intronic
1001471503 5:172016647-172016669 AAGTCTTCTAAGTATTGATATGG + Intergenic
1005593940 6:27359716-27359738 AAATGTACTGAGTGTAGAAAGGG - Intergenic
1007153830 6:39723280-39723302 ACATATACCCAGTATATATATGG + Intronic
1010498946 6:76570598-76570620 AAATCTGCTCAGAGTAGATTTGG + Intergenic
1010613630 6:77986053-77986075 AAATCAATTCAGTATATAAATGG + Intergenic
1011269288 6:85560441-85560463 AAATCTACTTTGTATATCTATGG - Intronic
1014461241 6:121698403-121698425 AAATCTACTAAATCTTGATAAGG + Intergenic
1014991403 6:128082692-128082714 AAATAAACTCTGTATAAATAAGG + Intronic
1016187661 6:141217869-141217891 ATATATACACAGTATATATAAGG + Intergenic
1016188530 6:141230330-141230352 AAATCAACTCAGGATAGATTAGG + Intergenic
1016727529 6:147392282-147392304 AAATCTACTCAGTATTTAGGAGG - Intergenic
1022252260 7:28620121-28620143 ATATTTAATCTGTATAGATAAGG + Intronic
1022971663 7:35523237-35523259 AAAAATACACAGTATATATAGGG - Intergenic
1024841560 7:53593092-53593114 AATTCTATTCAGAATAGAAATGG - Intergenic
1025040146 7:55635223-55635245 AAATGAATTCAGTAAAGATAGGG - Intergenic
1027649419 7:80846968-80846990 ACATGTACTCAGTATACAAAAGG - Intronic
1027920020 7:84381170-84381192 AACTCTACTCAATAAAGAGAGGG + Intronic
1030186457 7:106766827-106766849 AAATCTTCAAAGTATGGATACGG - Intergenic
1032878114 7:136059419-136059441 AAAGCCACTCATTAAAGATATGG - Intergenic
1034186379 7:149180480-149180502 AAATCAAGCCAGTATAGTTAAGG - Intronic
1035086066 7:156259169-156259191 AAAGCTACTAAGTACAGATTTGG - Intergenic
1039936261 8:42048938-42048960 AAATCCACTCAGTATAAAGCGGG + Exonic
1041224729 8:55687058-55687080 GAACCTACTGAGTCTAGATAAGG - Intergenic
1043705153 8:83339890-83339912 AATTTTACTCAGTATAGTTATGG - Intergenic
1044298632 8:90557308-90557330 AAACCTAGTCAGAAGAGATAAGG - Intergenic
1044494210 8:92857772-92857794 AAACCTAATCAATATAGAAAAGG - Intergenic
1044669422 8:94664020-94664042 AAATCTAGACAGTATACATGTGG - Intronic
1046164326 8:110410404-110410426 AAATCAACTCAAAATAGATTAGG + Intergenic
1049048999 8:140177211-140177233 AAATCTTCTCAGTCTTGAGATGG - Intronic
1051361303 9:16283931-16283953 AAATGTACTGAGTAAACATATGG + Intergenic
1052180558 9:25521417-25521439 AAATTTACACAGTAGAAATATGG + Intergenic
1052181340 9:25532602-25532624 AAATCTTCACATTATAGATGTGG + Intergenic
1053063007 9:35045855-35045877 AAATCTAGTCAGTAGAGAAAAGG + Exonic
1053100645 9:35369530-35369552 AAAATTAATCAGTATAGAAAAGG + Intronic
1055286047 9:74728983-74729005 AAATAGAATCAGTATATATAAGG + Intronic
1055796377 9:79978842-79978864 AAAAATACTCGATATAGATAGGG + Intergenic
1057451804 9:95169413-95169435 AAATATATTCCCTATAGATAAGG + Intronic
1057766128 9:97920991-97921013 AAGTCTACACAGTATAGGTTTGG - Intronic
1058285958 9:103178481-103178503 AAATTTACTCAGAACAAATATGG + Intergenic
1058982674 9:110184695-110184717 TATTCTACTCAATATAGAAATGG - Intergenic
1189027846 X:37416466-37416488 GAATGTAATCAGTATAGATAGGG + Intronic
1189474598 X:41340586-41340608 ATATATTCTCAGTATAGACAAGG - Intronic
1189601205 X:42628600-42628622 AAATCTATTCAGTACTTATAAGG - Intergenic
1189860480 X:45266068-45266090 AAATCTACTCTGCTTAAATATGG - Intergenic
1193808179 X:86017828-86017850 ATATGTTCTGAGTATAGATAGGG - Intronic
1194904725 X:99560518-99560540 ACACCTACTCAGTATAGTTCTGG + Intergenic
1195385240 X:104307956-104307978 AACTCTACTCAGAGTAGAAAAGG - Intergenic
1196104905 X:111885165-111885187 ATATCTAATCAGTCTAGATAAGG + Intronic
1197145093 X:123163211-123163233 AAATCAACTCATGATGGATAAGG - Intergenic
1198951083 X:142073307-142073329 AAATCTAGACAGTCTAGACAAGG - Intergenic
1201321916 Y:12708639-12708661 AAATTTTCACAGTATATATAAGG + Exonic