ID: 1170173702

View in Genome Browser
Species Human (GRCh38)
Location 20:13443364-13443386
Sequence CTATATCCACAGAGGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170173702 Original CRISPR CTATATCCACAGAGGGAACT GGG Intronic
900682005 1:3921851-3921873 CCACATCGAGAGAGGGAACTTGG + Intergenic
905256838 1:36690199-36690221 CTAGATTCACAGAAGGAAATAGG + Intergenic
905723755 1:40230157-40230179 ATATTTCTAAAGAGGGAACTGGG - Intronic
908782810 1:67707013-67707035 CTAAATCCCAAGAGAGAACTAGG - Intronic
912970631 1:114279060-114279082 CTATCTATACAGAGGCAACTTGG + Intergenic
913083645 1:115413689-115413711 CTATTTCCACATAAGGAAATTGG - Intergenic
913260033 1:116989365-116989387 TTATATCCCTAGAAGGAACTAGG - Exonic
920224938 1:204431630-204431652 CTATCTGCACAGAGGGATGTCGG - Intronic
922721065 1:227900560-227900582 CTATGTCTACAGGGGGACCTGGG + Intergenic
922721100 1:227900684-227900706 CCATGTCCACAGGGGGACCTGGG + Intergenic
923064310 1:230504111-230504133 CTATGGCCACACAGGAAACTGGG - Intergenic
924605354 1:245529609-245529631 CTATTTTCACACAGGGAACTTGG + Intronic
1064535118 10:16350338-16350360 CTCTGTCCACTGAGGCAACTAGG + Intergenic
1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG + Intronic
1064793236 10:18982925-18982947 TTATGTCCCCAAAGGGAACTTGG - Intergenic
1064883300 10:20081270-20081292 CTATATCCAGGGAGGGGAATAGG + Intronic
1067116315 10:43437706-43437728 CTATTTCCTCAGAAGGAACTGGG - Intronic
1075500921 10:122973408-122973430 ATTTATCCACAGAGGGAAAATGG - Intronic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1076076022 10:127534462-127534484 CTCTGTCCACAGTGGAAACTTGG + Intergenic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1081225002 11:40510724-40510746 GTATATCAACTGAGGCAACTAGG - Intronic
1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG + Intronic
1084815240 11:71641921-71641943 CTTGGTCCACAGAGGGAAATGGG + Intergenic
1089342225 11:117765833-117765855 CTCTGGCCTCAGAGGGAACTGGG - Intronic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1093118259 12:15237006-15237028 TTTTAACCACAGAGGAAACTGGG + Intronic
1096899110 12:54856079-54856101 CTATATGTACAAAGGGGACTGGG - Intronic
1097760159 12:63455313-63455335 TTTTTTCCACAGAGGAAACTGGG + Intergenic
1103751050 12:123161460-123161482 CTATATCCAGAAAGTGAAATTGG - Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1110749748 13:79098853-79098875 GGAAATACACAGAGGGAACTAGG - Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1134509693 16:14835902-14835924 CTATATCCACACTGGGGACAAGG - Intronic
1134563905 16:15234601-15234623 ATGTATCCACATTGGGAACTTGG - Intergenic
1134677724 16:16102366-16102388 CTCCATCCACTGAGGGCACTGGG - Intronic
1134697399 16:16234718-16234740 CTATATCCACACTGGGGACAAGG - Intronic
1134738589 16:16522095-16522117 ATGTATCCACATTGGGAACTTGG + Intergenic
1134974448 16:18559958-18559980 CTATATCCACACTGGGGACAAGG + Intronic
1135085907 16:19474308-19474330 CTATTTCCACAGAGAGAAGTGGG + Intronic
1144009567 17:11133780-11133802 TTATATTCACAGAGGGCAGTGGG - Intergenic
1144171593 17:12664517-12664539 CTAGATCCCCAAAGGGAACATGG + Intergenic
1148778929 17:50110907-50110929 CTATATACACAGAAGGTCCTAGG - Exonic
1148808441 17:50275812-50275834 ATATATACAGAGAGGGAACTTGG - Intronic
1155008877 18:21755170-21755192 CCATTTCCTCAGATGGAACTAGG + Intronic
1155324452 18:24651854-24651876 CTTTATCAACAAAGGGCACTGGG - Intergenic
1157046096 18:44103619-44103641 CTATCTCCACAGAGGAGCCTTGG - Intergenic
1160796410 19:947771-947793 GTATTTCCAGAGAGGGGACTCGG + Intronic
1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG + Exonic
926697791 2:15782764-15782786 CTATATCATCAGAGGCAACGGGG + Intergenic
927852352 2:26507742-26507764 CTAAATCCTCAGAGGGTCCTGGG - Intronic
929820430 2:45269155-45269177 CTACATCAACAGAGAGAACTGGG + Intergenic
931678672 2:64724113-64724135 CCATCTCCACCGTGGGAACTGGG + Intronic
933754667 2:85628838-85628860 CTTTAACCACAGAGGGGATTAGG - Intronic
934165976 2:89294550-89294572 CTACATCCACATAGGGGAATAGG + Intergenic
934201301 2:89887906-89887928 CTACATCCACATAGGGGAATAGG - Intergenic
934497028 2:94812204-94812226 CTTTATCCTCAGAGTTAACTGGG - Intergenic
940399382 2:153229727-153229749 CTATATTCACAGAAAGCACTTGG + Intergenic
943324397 2:186480605-186480627 ATATATCCAAAAAGGGAACAAGG + Intergenic
945772739 2:214065139-214065161 CTATGTCCACAGAGCTAACAAGG + Intronic
947109964 2:226708068-226708090 TTATATCCACAGAGGGACTTGGG - Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1172327240 20:34045818-34045840 AGAAATCCACAGAGGGAAATTGG + Intronic
1173262212 20:41446641-41446663 CTATCCCCACAGAGGGAGCTGGG - Intronic
1175108124 20:56628761-56628783 CTGTGCCCACGGAGGGAACTGGG + Intergenic
952996181 3:38884678-38884700 CTATATCCACTCAAGGAATTAGG + Intronic
954926124 3:54236371-54236393 GGATAACCACAGAGGAAACTGGG + Intronic
956596842 3:70976541-70976563 CTATCTCCAGAGATGGAACCTGG - Intronic
957072467 3:75577815-75577837 CTTGGTCCACAGAGGGAAATGGG - Intergenic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
963353517 3:144181329-144181351 CTAAATAGACAGAAGGAACTTGG - Intergenic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
969737891 4:9003219-9003241 CTTGGTCCACAGAGGGAAATGGG + Intergenic
969880111 4:10166286-10166308 CTATATCTGAAGAAGGAACTAGG - Intergenic
970008465 4:11432359-11432381 CTTTATCCACAAAGGAAATTGGG + Intergenic
970264836 4:14270722-14270744 CTATCTCCAAAGATGCAACTTGG - Intergenic
970441742 4:16085987-16086009 CTATTTCCTCTGAGGGAAATTGG - Intergenic
970485155 4:16517635-16517657 TTATATTCAAAGAGGGATCTCGG - Intronic
970805034 4:20021178-20021200 CTATATGCACGTAGGGGACTAGG - Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
977250677 4:94685259-94685281 CTACAACCACAGAGAGAACTGGG - Intergenic
980717211 4:136641797-136641819 CTATATCCACAGATAATACTTGG + Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
982958037 4:161795551-161795573 CAATATACACAGAGTGAAATTGG + Intronic
984030296 4:174596133-174596155 CAATATCAACAGAGGAAAGTGGG - Intergenic
986540939 5:8843199-8843221 CTATCTGCACAGAGTGAACATGG + Intergenic
986821184 5:11468523-11468545 CTGTATCTACAGAGAGATCTGGG - Intronic
988642542 5:33057252-33057274 CTATCTCCAGAGAAGAAACTGGG + Intergenic
991356116 5:65770520-65770542 CCATATCCACAAAGATAACTTGG - Intronic
993869332 5:93232755-93232777 CCAAATCCACAGAAGGAAATGGG + Intergenic
995962733 5:117863136-117863158 CTATGTCTACTGAGGGAACTAGG - Intergenic
997634430 5:135394491-135394513 CCACATCCATTGAGGGAACTGGG - Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998984823 5:147744743-147744765 CTATATCCACACAAGGATCTGGG - Intronic
1003832666 6:10031465-10031487 CTATCTCCACAAAGTGGACTTGG + Intronic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1005728427 6:28672093-28672115 ATATATCCAGAGTGGTAACTGGG + Intergenic
1006663830 6:35674393-35674415 CCATATGTACTGAGGGAACTTGG - Intronic
1007277388 6:40685158-40685180 CAATAACCACAGAGTGAACTTGG - Intergenic
1008516883 6:52326926-52326948 CAATATCCAAAGAGGGAAAGTGG + Intergenic
1008683265 6:53896985-53897007 GTATTTCCACAGATGTAACTTGG + Intronic
1010441297 6:75898041-75898063 CTAAATCCATACAGGAAACTTGG - Intronic
1011864953 6:91813934-91813956 CTCTATCCAGAGAGTGGACTGGG - Intergenic
1014759452 6:125340508-125340530 TTATATCCATACAGGGAACTTGG - Intergenic
1014780948 6:125563969-125563991 TTATATTCCCAGAGAGAACTGGG + Intergenic
1016601593 6:145867712-145867734 CTATAACCACAGAGGTAGTTTGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1018908061 6:168086650-168086672 CCATGTCCACAGTGGGAACATGG - Intergenic
1020648382 7:10843968-10843990 CTATCTCTACAGAGTGAGCTTGG - Intergenic
1021060077 7:16100431-16100453 CTATGTCCACAGTAGGCACTCGG + Intronic
1021310658 7:19091914-19091936 CTTTATCCCCAAAGGCAACTTGG - Intronic
1024111303 7:46149468-46149490 CAATATCCACAGTGGGATCCTGG - Intergenic
1025147121 7:56514450-56514472 ATATATGCACTGAGGGAACTGGG - Intergenic
1026319246 7:69254656-69254678 GTATATGCACTGAGGGAACTGGG + Intergenic
1029045818 7:97627105-97627127 CTCTCTCCACAGACGGAAGTAGG - Intergenic
1032253950 7:130282321-130282343 CTAGATTCACTGAGGGAAATTGG - Intronic
1040851944 8:51909951-51909973 ATATAGCCACAGTGGGAATTAGG + Intergenic
1041534690 8:58912898-58912920 GTATATCCACAGAGTGACTTAGG + Intronic
1043615067 8:82115098-82115120 CTATATCAAAAGAGGGGCCTTGG - Intergenic
1045615412 8:103903910-103903932 ATATAACCACTGAGGAAACTCGG - Intronic
1046842671 8:118877512-118877534 CTAAAAGCACAGTGGGAACTGGG + Intergenic
1047291287 8:123532504-123532526 CTATGAACACAGAGGGAATTGGG + Intronic
1047554595 8:125915424-125915446 CCTTATACACAGAGGGGACTCGG - Intergenic
1050119238 9:2291282-2291304 ATATATCCACAGAGGGAAAAGGG - Intergenic
1051470437 9:17433959-17433981 CTATATCAACAGAGTAAATTGGG - Intronic
1057680473 9:97177058-97177080 CTTTATCCTCAGAGTTAACTGGG - Intergenic
1186171964 X:6886640-6886662 CTATCTCCACAGAGATATCTTGG - Intergenic
1186189211 X:7052704-7052726 TTACTTTCACAGAGGGAACTTGG + Intronic
1187361022 X:18627840-18627862 CAATATCGAGAGAGGGAAATTGG + Intronic
1188285785 X:28324181-28324203 CTATATACACAGAGGTAACTAGG + Intergenic
1188514962 X:30975402-30975424 CTATCTCCAGAGAGGGAAGGAGG + Intergenic
1191227954 X:58065482-58065504 CAATAAACACTGAGGGAACTCGG - Intergenic
1199374890 X:147096759-147096781 CTATATAAACAGAGTGAGCTTGG + Intergenic
1200942927 Y:8804351-8804373 CTCCACCCACAGAGGGAAGTCGG + Intergenic