ID: 1170179106

View in Genome Browser
Species Human (GRCh38)
Location 20:13509170-13509192
Sequence CAGGATTTTCTTGGTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2466
Summary {0: 1, 1: 0, 2: 46, 3: 391, 4: 2028}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170179106_1170179110 8 Left 1170179106 20:13509170-13509192 CCTTTAAAACCAAGAAAATCCTG 0: 1
1: 0
2: 46
3: 391
4: 2028
Right 1170179110 20:13509201-13509223 GACAACATGGATGAACTTAGAGG 0: 2
1: 84
2: 525
3: 1616
4: 3036
1170179106_1170179111 16 Left 1170179106 20:13509170-13509192 CCTTTAAAACCAAGAAAATCCTG 0: 1
1: 0
2: 46
3: 391
4: 2028
Right 1170179111 20:13509209-13509231 GGATGAACTTAGAGGATATCAGG 0: 1
1: 0
2: 1
3: 23
4: 194
1170179106_1170179108 -5 Left 1170179106 20:13509170-13509192 CCTTTAAAACCAAGAAAATCCTG 0: 1
1: 0
2: 46
3: 391
4: 2028
Right 1170179108 20:13509188-13509210 TCCTGTCATTTGTGACAACATGG 0: 124
1: 491
2: 1586
3: 3034
4: 4404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170179106 Original CRISPR CAGGATTTTCTTGGTTTTAA AGG (reversed) Intronic
Too many off-targets to display for this crispr