ID: 1170181977

View in Genome Browser
Species Human (GRCh38)
Location 20:13541685-13541707
Sequence AGAGGTGTCAAGGGCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170181977_1170181982 6 Left 1170181977 20:13541685-13541707 CCAGAAAAGCCCTTGACACCTCT 0: 1
1: 1
2: 1
3: 15
4: 139
Right 1170181982 20:13541714-13541736 CTCAGTAAACACTTGTTGAATGG 0: 1
1: 6
2: 65
3: 250
4: 1215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170181977 Original CRISPR AGAGGTGTCAAGGGCTTTTC TGG (reversed) Intronic
902678802 1:18028756-18028778 AGAGCTGTCAGGTGCTGTTCTGG - Intergenic
903665878 1:25007170-25007192 AGATGTGGGAAGGGCATTTCAGG + Intergenic
905590041 1:39155546-39155568 AGAGGTCTTAAGGTCATTTCAGG + Intronic
905631695 1:39522370-39522392 AGAAGGGGCAAGGTCTTTTCTGG - Intronic
905666058 1:39763802-39763824 AGAAGGGGCAAGGTCTTTTCTGG + Exonic
906490928 1:46267830-46267852 AGAGGTGGCAGGGGCTATACAGG + Intronic
907653649 1:56320729-56320751 AGAGGTGTGAAGTGACTTTCTGG - Intergenic
908342399 1:63195087-63195109 GGAAGTGTCCAGGGCTTTTAAGG - Intergenic
909565381 1:77047878-77047900 AGAGCTGTCATGTGCTTTTTAGG - Intronic
910306979 1:85775681-85775703 AGAGGTGAAAAGGGCTTTAGAGG - Exonic
911586051 1:99692225-99692247 AGAGGTGTCAGTGGCATTCCAGG + Intronic
911604727 1:99890966-99890988 AGAGATATAAAGAGCTTTTCAGG - Intronic
917223354 1:172755638-172755660 AGCTGTGTCAAGGGTGTTTCTGG + Intergenic
920834853 1:209501632-209501654 CTTGGTGTCAAGGGCTTTTGGGG + Intergenic
921596483 1:217059541-217059563 AGAGCTATCAAAGGCTTTTAAGG + Intronic
921901364 1:220454926-220454948 AGAGCTCTCTAGAGCTTTTCTGG + Intergenic
923100353 1:230809410-230809432 AGAGGTAACCAGGGCTTTGCTGG - Intergenic
1066408237 10:35140787-35140809 AGAAGGGTAAAGGGCATTTCAGG + Intronic
1067576304 10:47410792-47410814 AGAGGTCTGAGGGGATTTTCTGG - Intergenic
1069133923 10:64740584-64740606 AGAGGTCTGATGGGCTTCTCAGG - Intergenic
1070344921 10:75532262-75532284 AGAGGTGACAAAGGCATTCCTGG + Intronic
1070669619 10:78368866-78368888 GGATGTGTCAAGGCCTCTTCAGG + Intergenic
1078302862 11:10151244-10151266 AGAGATGCCAAGGGATTTTCTGG - Intronic
1079770740 11:24455411-24455433 ATGGTTGCCAAGGGCTTTTCAGG - Intergenic
1080261346 11:30352758-30352780 AGGGCTGACAAAGGCTTTTCTGG + Intergenic
1082978140 11:59095529-59095551 TAAGGGGTCAAGGGCATTTCAGG + Intergenic
1087994239 11:104783673-104783695 AGAGGAGCTTAGGGCTTTTCTGG - Intergenic
1089337825 11:117737273-117737295 ACAGCTGTAAAAGGCTTTTCAGG + Intronic
1092106458 12:5925083-5925105 AGAGGTTTCCAGGTCTTCTCTGG - Intronic
1093340871 12:17972545-17972567 AGATTTCTCAAGGGTTTTTCAGG + Intergenic
1093962337 12:25287930-25287952 TGAGGGGTCAAGAGCCTTTCAGG - Intergenic
1093977261 12:25437201-25437223 AGAGGTGTCCGGGGCCTTTTGGG + Intronic
1095380810 12:41589090-41589112 AGAGGTGTCACTGGATTTACAGG + Intergenic
1098984689 12:76999049-76999071 AGAGATGTTAAGTGATTTTCAGG - Intergenic
1100450902 12:94705680-94705702 ACTGCTGTCAATGGCTTTTCTGG + Intergenic
1108720545 13:53127125-53127147 AGAGGTTTTAAGAGCTTCTCTGG + Intergenic
1110811073 13:79810994-79811016 AGAGGTGGCAAGAGCATTTGTGG - Intergenic
1111717569 13:91898521-91898543 AGCGGTCTCAAAGGCTTTTCTGG + Intronic
1114367948 14:22050456-22050478 AGAGGTTTCATTGGCTGTTCAGG + Intergenic
1115025191 14:28736512-28736534 ACAGGTGAAAAGGGCCTTTCTGG + Intergenic
1117020403 14:51564658-51564680 AGAGAGGTCAAGGGCTCTTTTGG + Intronic
1119538922 14:75426473-75426495 AAAGGTGTCATTGGCCTTTCTGG + Intergenic
1119558306 14:75570048-75570070 AGAGGGGGGAAGGGCTTTCCAGG - Intergenic
1122082911 14:99279050-99279072 AGAGGTGTCATGGGCCTCCCTGG + Intergenic
1122421330 14:101579362-101579384 AGTGGTGTCAGGGGCTTCCCAGG - Intergenic
1123737949 15:23203348-23203370 AGCTGTCTCAGGGGCTTTTCTGG + Intergenic
1124289160 15:28432017-28432039 AGCTGTCTCAGGGGCTTTTCTGG + Intergenic
1124294062 15:28485293-28485315 AGCTGTCTCAGGGGCTTTTCTGG - Intergenic
1126648369 15:50897387-50897409 AGAGTTGTCAAGGTCTTTGCTGG + Intergenic
1129040965 15:72685987-72686009 AGGGGTGTTAGGGGCTTCTCGGG + Exonic
1129111935 15:73342192-73342214 AGAGGAGCTAAGGGCTTTGCTGG - Intronic
1129299311 15:74616206-74616228 AGGGGTCTGAAGGGCTTCTCTGG - Intronic
1129624465 15:77182313-77182335 AGTGGTATCAAAGGCATTTCTGG - Intronic
1130997032 15:88909656-88909678 GGAGGTGTCAAGGCCTCCTCTGG - Intronic
1132643688 16:989246-989268 ACAGGTGTCCAGGGCTTGTCTGG - Intergenic
1135669708 16:24364853-24364875 AGAGGTGTTAAAGGATATTCTGG + Intergenic
1143389174 17:6549969-6549991 AGAGGGGGCAAGGCCTCTTCAGG + Intronic
1145778220 17:27544206-27544228 AGTGGTGTCAAGGGACTTTAGGG + Intronic
1147513619 17:41095543-41095565 AGAGTTGTCCCGGCCTTTTCCGG + Intronic
1149928773 17:60728241-60728263 AGGGGTGCCCAGGGCTTATCAGG - Intronic
1151419228 17:73986493-73986515 AGAGGTGGCCATGGCTGTTCGGG - Intergenic
1157579479 18:48765030-48765052 AGAGGTGGAGTGGGCTTTTCTGG + Intronic
1158988630 18:62845810-62845832 TGAGGAGTCAAGGGCTTTTCTGG + Intronic
1162330677 19:10027421-10027443 GGAGGTGTCAGGAGCTTCTCAGG - Intergenic
1163234311 19:16022151-16022173 AGATGGGTCAGGGGCTTCTCAGG + Intergenic
1163670157 19:18622896-18622918 GGAGGAGTCAAGGTCTTTCCTGG + Intergenic
1163674484 19:18648615-18648637 AGAGGCATGAAGGGCTTTTCTGG - Intronic
1164632305 19:29769567-29769589 AGAGGAGTCAAGGGGATTTTTGG - Intergenic
925134497 2:1516713-1516735 AGTGGTCTAAATGGCTTTTCTGG + Intronic
926140927 2:10367660-10367682 ATATGGGACAAGGGCTTTTCTGG - Intronic
927176143 2:20410277-20410299 CTTGGTGTCAAGGGCTTTTAGGG + Intergenic
927448043 2:23183105-23183127 GGAGGTATGAAGGGCCTTTCTGG - Intergenic
927493565 2:23536977-23536999 TGTGGTGTAAAGGGCTGTTCTGG + Intronic
927935921 2:27076529-27076551 AGTGGTGTCATGGGATTTGCTGG + Intergenic
929029159 2:37634864-37634886 AGAGATGTCCAGGGCTCATCTGG + Intergenic
929559857 2:42949460-42949482 AGAGGTGTTAGGGGTTTTGCAGG + Intergenic
929794864 2:45051349-45051371 AGTGGTGTCCAGGGCCTGTCGGG - Intergenic
931863862 2:66388884-66388906 AGAGGTATCAAAGACTTTGCCGG - Intergenic
932450817 2:71809637-71809659 AGCGCTTTCAAGGGCTTTTAGGG - Intergenic
936321403 2:111469918-111469940 AGAAGAGTCAAGAGGTTTTCAGG + Intergenic
936404955 2:112194663-112194685 AGAGGTTTCAAAGGATTTTAGGG + Intergenic
936586298 2:113761288-113761310 ATAGGTTTCAAGGGGTTTACTGG + Intergenic
936632036 2:114214304-114214326 AGAGGTGTCAAGGGTTTTTCTGG + Intergenic
937145238 2:119638852-119638874 AGGGGTGTCAGGGGATATTCAGG - Intronic
937821647 2:126317343-126317365 TGAGGTGTCAGGGGCTGCTCAGG + Intergenic
942220542 2:173764890-173764912 AGAGCTGTCCAGAGCTTCTCTGG + Intergenic
942397161 2:175562729-175562751 GGAGGTGTCAAAGGCTTTGGTGG - Intergenic
943524125 2:188995369-188995391 AGAGTTTTCAAAGACTTTTCAGG - Intronic
947357099 2:229308179-229308201 ATAGCTGTCAATGGCTCTTCAGG + Intergenic
948920381 2:241063553-241063575 AGGGGTGTCAAGGGTGTTGCTGG - Intronic
1169287057 20:4318191-4318213 ACAGGTCTCAAGGGCTTGGCTGG + Intergenic
1170181977 20:13541685-13541707 AGAGGTGTCAAGGGCTTTTCTGG - Intronic
1170928690 20:20748772-20748794 AGAAGTGTCCAGGCCTTTTAAGG - Intergenic
1171345908 20:24466289-24466311 AGAGGGGTCAAGGGCATGTCCGG - Intergenic
1174135582 20:48376526-48376548 AGAGCTGTCAAAGGCTCATCAGG + Intergenic
1181558971 22:23688691-23688713 AGAGGTGTCAGTGGCCTGTCTGG - Intronic
1181885866 22:26022048-26022070 AGAAGTCTCCAAGGCTTTTCTGG + Intronic
1182023211 22:27098310-27098332 AGAGCTGTAAATGGCTTTCCTGG + Intergenic
1182085845 22:27560691-27560713 AGTGGTGTCAGGGGCCTATCTGG + Intergenic
1184339836 22:43880213-43880235 AGGGGGGTCCAGGTCTTTTCAGG - Exonic
957115946 3:76026901-76026923 AGAGGTCTCAAGGACCTTCCAGG + Intronic
960583695 3:119301676-119301698 AGAGGTTTCCTGGGCTTTTGTGG + Intronic
967231389 3:187340733-187340755 ATAGGTCTCCAGGTCTTTTCTGG + Intergenic
970958795 4:21848200-21848222 GGTGGTGCCATGGGCTTTTCAGG - Intronic
971735685 4:30447497-30447519 AGGGTTGTGGAGGGCTTTTCAGG + Intergenic
972638428 4:40904750-40904772 AGAGGTGTCTGGGGATTCTCTGG + Intronic
973283586 4:48389577-48389599 AGCAGTGTGAAGGGATTTTCAGG + Intronic
983304777 4:165972234-165972256 AGAGCTTTCATGGGCTTTTCTGG - Intronic
987499117 5:18683192-18683214 CTAGGTGTCAAGGAATTTTCAGG + Intergenic
987927996 5:24365861-24365883 AGATGTGCCAAGGTCTTTGCTGG - Intergenic
988131940 5:27117917-27117939 AGAAAAGTCAAGGGCTTTCCAGG - Intronic
989563120 5:42873625-42873647 AAAGCTGTCAAAGTCTTTTCAGG + Intronic
993628930 5:90260099-90260121 AGATGTGGCATGGGCTTTCCAGG + Intergenic
995802735 5:116017052-116017074 AGAGATGGCAAGGGCTTTTGGGG + Intronic
996013609 5:118507261-118507283 AGGGATGTACAGGGCTTTTCAGG + Intergenic
996895626 5:128478618-128478640 TGATATGTCAAGGTCTTTTCAGG + Intronic
997647476 5:135490804-135490826 AAAGGTGGAAGGGGCTTTTCCGG - Intergenic
998444889 5:142191090-142191112 AGAGTGGGCATGGGCTTTTCTGG - Intergenic
998472671 5:142395488-142395510 AGAGGTGTGAAGTGTTTCTCTGG + Intergenic
999988357 5:157025761-157025783 ACAGGTGTCAGGTGCTCTTCAGG - Intergenic
1001203265 5:169738403-169738425 AGAGGGGTAAATGGCTTTTGGGG + Intronic
1002932991 6:1647063-1647085 AAAGGTGACAAGGGCTGCTCAGG + Intronic
1004319198 6:14619399-14619421 AGAGGTGGCCAGGGCTGTTGGGG - Intergenic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1006403547 6:33831452-33831474 AGAGGTCTCCAGGGCTTGTCTGG - Intergenic
1006445066 6:34075414-34075436 AGACGTGAGAAGGGCATTTCTGG - Intronic
1011934037 6:92753266-92753288 CTAGGTATCAAGGGCTTTTAGGG + Intergenic
1012341917 6:98137455-98137477 AGAGGTGTCAAGAGCCTTGCTGG - Intergenic
1014180756 6:118381687-118381709 GGAGAGGTCAAGGGCTTTTAAGG - Intergenic
1016587324 6:145704667-145704689 GGAGGTGTCAAAGGCTTTTTAGG - Intronic
1016745928 6:147580317-147580339 AGAGGTGTCAGGGGATGTTTAGG - Intronic
1017386005 6:153884180-153884202 AGAGGTTACAAGGGGTTTACAGG + Intergenic
1020434399 7:8147159-8147181 GGAGCTGTCAAGGGCATGTCAGG - Intronic
1021749502 7:23780816-23780838 AGAGGTGTGCAGGGTTTTTATGG + Intronic
1022631868 7:32093021-32093043 AGAGGGTTCATGGGATTTTCAGG + Intronic
1029199132 7:98827071-98827093 AAAGGTGTCCAGGGCTGTGCTGG - Intergenic
1031821382 7:126506450-126506472 AGAGGTGGGAAGGGGTTTTCTGG - Intronic
1032872854 7:136004717-136004739 AGAGCTGGGAAGGGCTTTGCAGG + Intergenic
1035341895 7:158167434-158167456 AGAGATGTCCAGGGCTGTTTAGG - Intronic
1037929630 8:22870850-22870872 AGAGGTCCCAAGGGCTTCTCTGG - Intronic
1040705972 8:50127508-50127530 AGAAGTCTCAAGGGCTTTCTTGG + Intronic
1041778393 8:61550533-61550555 AGATGTGGCCTGGGCTTTTCTGG - Intronic
1047379217 8:124341854-124341876 AGATGTTTCAAGGGCTTGACCGG - Intronic
1049448202 8:142641317-142641339 GGAGGTGTCCAGGGCTTTGCAGG - Intergenic
1051149421 9:14064247-14064269 AGAGGGGTTATGGGCATTTCAGG - Intergenic
1051754538 9:20383724-20383746 TGAAGTGTCAAGTGTTTTTCAGG - Intronic
1051860583 9:21621210-21621232 AGAGGTGTCTAGGTGCTTTCAGG + Intergenic
1053411148 9:37916814-37916836 TGAGGAGTCAAGGGCCCTTCTGG - Intronic
1055132465 9:72792130-72792152 AGAGATTTCAAAGGCATTTCTGG - Intronic
1059490438 9:114662168-114662190 AAAGATGTCAAGTGCTTTGCAGG + Intergenic
1059704332 9:116806330-116806352 AGGCTTGTCAAGGGCTTTTCTGG - Intronic
1060588610 9:124802079-124802101 AGAAGTGACAAGGGCTTTCAGGG + Intronic
1186571812 X:10723045-10723067 AGGGATGTCAAGGGTGTTTCTGG + Intronic
1193152143 X:78136885-78136907 AGAGGAGACAATGGCATTTCTGG - Intronic
1193868270 X:86763758-86763780 AGAGGTGTAAGGGGAATTTCTGG + Intronic
1196475450 X:116079190-116079212 AGAGTTGTCATGTGCTTTTGGGG - Intergenic
1197757994 X:130009697-130009719 AGAGGGGTCATGGCCATTTCTGG + Intronic