ID: 1170184385

View in Genome Browser
Species Human (GRCh38)
Location 20:13571870-13571892
Sequence CAGGGTGAAGACCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 1, 2: 7, 3: 54, 4: 512}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170184385_1170184388 -5 Left 1170184385 20:13571870-13571892 CCAGCCTCAGGGTCTTCACCCTG 0: 1
1: 1
2: 7
3: 54
4: 512
Right 1170184388 20:13571888-13571910 CCCTGAATGTTCCCTCTGTCTGG 0: 1
1: 0
2: 0
3: 34
4: 304
1170184385_1170184393 19 Left 1170184385 20:13571870-13571892 CCAGCCTCAGGGTCTTCACCCTG 0: 1
1: 1
2: 7
3: 54
4: 512
Right 1170184393 20:13571912-13571934 TCTTTCCCTATTTCCCAAATGGG 0: 1
1: 0
2: 2
3: 34
4: 485
1170184385_1170184392 18 Left 1170184385 20:13571870-13571892 CCAGCCTCAGGGTCTTCACCCTG 0: 1
1: 1
2: 7
3: 54
4: 512
Right 1170184392 20:13571911-13571933 CTCTTTCCCTATTTCCCAAATGG 0: 1
1: 0
2: 1
3: 47
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170184385 Original CRISPR CAGGGTGAAGACCCTGAGGC TGG (reversed) Intronic
900092455 1:926303-926325 CAGGGAGAAGACCCTGACCCAGG - Intronic
900400201 1:2469896-2469918 CTGGGTGAAGACCCCGAGAGGGG + Intronic
900960816 1:5918198-5918220 CATGGACAAGACCCTTAGGCAGG + Intronic
901102045 1:6726446-6726468 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
901634970 1:10666296-10666318 GCTGGAGAAGACCCTGAGGCAGG - Intronic
901749649 1:11397873-11397895 GAGGGTGAAGACGCTTAGTCTGG - Intergenic
901844276 1:11972089-11972111 CAGGCTGGATTCCCTGAGGCAGG - Intronic
902447055 1:16474205-16474227 CAGGGAAAAGGCCCTGAGGCGGG + Intergenic
902659940 1:17894065-17894087 CAGGGTGCTGACCCTTAGGAAGG - Intergenic
903044103 1:20553027-20553049 CAAGGCGAAGAGCCTGAGTCCGG + Exonic
903238516 1:21966763-21966785 CCAGGAGAAGACTCTGAGGCAGG - Intergenic
903301334 1:22380547-22380569 ATGGGAGAAGAGCCTGAGGCAGG + Intergenic
904332366 1:29768483-29768505 CAGGGAGAAGAGGCTGAGGCAGG + Intergenic
904438607 1:30515364-30515386 AAGGGCGTAGGCCCTGAGGCCGG - Intergenic
904580692 1:31541701-31541723 CAGTGTGAAGGCTCGGAGGCGGG - Intergenic
904893638 1:33797973-33797995 CAGAGTGCCGACCCTGATGCAGG + Intronic
904995016 1:34624955-34624977 CAAGGGAAAGATCCTGAGGCTGG + Intergenic
905127664 1:35726901-35726923 GAGGGTGAACACCCTAAGGGAGG + Intronic
907244321 1:53098231-53098253 CAGGGTGAGTATACTGAGGCGGG - Intronic
907245043 1:53103153-53103175 CAGGGGGAAGCCCCTGGGGTGGG + Intronic
908797889 1:67849618-67849640 ACGTGTGAAGATCCTGAGGCAGG + Intergenic
910160771 1:84270101-84270123 AAGTGTGAAGGCCCTGAGGTAGG + Intergenic
910270578 1:85390107-85390129 TAGGGTGAGGACACTGAGGCAGG - Intronic
912264086 1:108137957-108137979 ATGTGTGAAGACACTGAGGCAGG - Intronic
912563375 1:110566207-110566229 CTGGGAGAAGTCCCAGAGGCAGG + Intergenic
912712984 1:111962696-111962718 CATGGTTAGGACCCTGAGGCTGG + Intronic
913199355 1:116483647-116483669 CTGAGTGAAGACTCTGAGGCAGG + Intergenic
915286018 1:154852863-154852885 CAAGGTGAAGGCCCTGAGGGGGG - Intronic
915602664 1:156932081-156932103 CGGGGTAAACACCCTCAGGCAGG - Intronic
916170613 1:161998972-161998994 CAGAGAAAAGGCCCTGAGGCAGG + Intronic
916447360 1:164885680-164885702 AAGGGCAAAGACCCTGAGGTAGG - Intronic
916773739 1:167937459-167937481 GAGCGTGAAGTCCCTGAGGGTGG - Intronic
917283620 1:173402630-173402652 CATGGTGATGACCTTGAAGCAGG - Intergenic
917539590 1:175899845-175899867 CAGTGCGAAGGCCCTGAGGCAGG + Intergenic
917932556 1:179833211-179833233 CTGGGTGAAGACCATGAGCAGGG - Intergenic
918130022 1:181619343-181619365 AAGTGTGAAGGCCCTGAGGAAGG + Intronic
919650837 1:200147738-200147760 CACGGTGAAGACGCGGATGCCGG + Intronic
919731984 1:200918866-200918888 AAGTGTGAAGGCCCAGAGGCAGG - Intergenic
919801788 1:201358842-201358864 CAGGGTGCAGCCCAGGAGGCAGG - Intergenic
919804834 1:201375379-201375401 CAGGGTGAGGACAGTGAGGGAGG + Intronic
921816861 1:219574178-219574200 TAGTGCAAAGACCCTGAGGCAGG + Intergenic
922588479 1:226753877-226753899 CAGAGTAGAGGCCCTGAGGCAGG + Intergenic
923981448 1:239328526-239328548 GGAGGTGAAGACCTTGAGGCAGG - Intergenic
1062787918 10:280650-280672 CCAGGTGAGGACTCTGAGGCTGG - Intronic
1062992377 10:1832593-1832615 CAGTGCAAAGACCCTGGGGCAGG + Intergenic
1063819493 10:9818886-9818908 CAGAGTGAAGACACAGAAGCTGG + Intergenic
1063987958 10:11527264-11527286 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1066054188 10:31665053-31665075 CAGGTTGCAGATCCTGTGGCCGG + Intergenic
1066600496 10:37100851-37100873 CTGTGTGACGACTCTGAGGCAGG + Intergenic
1068150200 10:53121662-53121684 CAGGGTGAGGACACTGAGGTTGG + Intergenic
1069943758 10:71972484-71972506 CGGGCAAAAGACCCTGAGGCAGG - Intronic
1070383362 10:75901953-75901975 CTGGGTCAAAACCCTGAGGCTGG - Intronic
1070402863 10:76068701-76068723 CAGGTTGGACACCCTAAGGCAGG - Intronic
1070629341 10:78073650-78073672 CAGTTTGAAGACCCTGAGAGAGG - Intergenic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072756644 10:98025913-98025935 CAAAGTGAAAACCCTGAGGTGGG + Intronic
1072897835 10:99382082-99382104 CAGGGCGAAGCCCCTGTGGTTGG + Intronic
1073027299 10:100497350-100497372 CAGGGAGAGGACCATGAGCCTGG + Intronic
1073559717 10:104486491-104486513 AAGGGTGAATACTCTGGGGCAGG + Intergenic
1074307555 10:112292876-112292898 CAGGATAAAGGCCCTGGGGCAGG - Intronic
1074540985 10:114364991-114365013 CAGGATGAAGAGCCAGAGTCCGG + Intronic
1074683381 10:115933854-115933876 AAGGGAGAAGACCCAGAGGAGGG - Intronic
1075313116 10:121431127-121431149 CAGGGTGAGGACGCAGATGCAGG - Intergenic
1075341919 10:121653782-121653804 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1075357348 10:121792407-121792429 CAGGGTGAAGACCAGAAGTCAGG + Intronic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1075851885 10:125595651-125595673 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1075915449 10:126162427-126162449 CAGGGCGCAGGGCCTGAGGCAGG + Intronic
1075977398 10:126707618-126707640 CAGAGTGGAGACCCTGGGGTGGG - Intergenic
1076836536 10:133023865-133023887 GAGCTTGAAGACCCTGGGGCTGG - Intergenic
1077002762 11:332830-332852 CTGGGTGAGGACGCTGACGCCGG - Intergenic
1077083157 11:734757-734779 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083172 11:734810-734832 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083187 11:734863-734885 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083202 11:734916-734938 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083265 11:735131-735153 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083280 11:735184-735206 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083341 11:735398-735420 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083357 11:735452-735474 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083404 11:735613-735635 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083419 11:735666-735688 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083494 11:735933-735955 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083525 11:736040-736062 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083556 11:736147-736169 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083587 11:736254-736276 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083630 11:736415-736437 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077083645 11:736469-736491 CCCCGTGAAGACCCTCAGGCGGG - Intergenic
1077341278 11:2027483-2027505 GAGGGTGAAGCCCGTGAGCCTGG - Intergenic
1077918738 11:6627385-6627407 CAGGCTCATGACCCTGATGCTGG - Exonic
1078094534 11:8288728-8288750 AAGGAAAAAGACCCTGAGGCAGG + Intergenic
1078869574 11:15330855-15330877 TGGTGTGAAGACCCTGAGGAAGG - Intergenic
1078869581 11:15330886-15330908 GGGTGTGAAGACCCTGAAGCAGG - Intergenic
1080744551 11:35097067-35097089 CTGGGTGCAGGCCCTGAGGAGGG + Intergenic
1081002782 11:37695483-37695505 CAGCATGAAGACCCTGGGCCTGG - Intergenic
1081683304 11:45023885-45023907 AAGTGTGAAGACTTTGAGGCTGG - Intergenic
1081743196 11:45455281-45455303 CTGGATGCAGAGCCTGAGGCAGG - Intergenic
1083047468 11:59749719-59749741 GGAGGTGAAGAACCTGAGGCTGG - Intronic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1084014766 11:66371838-66371860 CAGAGTCGAGTCCCTGAGGCGGG - Intronic
1084062492 11:66685513-66685535 CAGGAGAATGACCCTGAGGCAGG + Exonic
1084169764 11:67395488-67395510 CAGGGAGAGGGCCCAGAGGCAGG - Intronic
1084561499 11:69908040-69908062 CAGGGTGGGGAAACTGAGGCAGG + Intergenic
1084586529 11:70065757-70065779 CCAGGTGAAGGCCTTGAGGCTGG - Intergenic
1085043703 11:73341663-73341685 ATGGGCCAAGACCCTGAGGCAGG + Intronic
1085341527 11:75734631-75734653 AAGGGTGAGGCCTCTGAGGCAGG - Intergenic
1085447009 11:76607647-76607669 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1086097069 11:83061027-83061049 GAGGCTGAAGACCCAGAGACTGG - Intronic
1086720952 11:90120332-90120354 GAGGGTGGATAACCTGAGGCCGG - Intergenic
1087052754 11:93903109-93903131 AAGGATGAACGCCCTGAGGCGGG + Intergenic
1088651174 11:111958949-111958971 CAGAGTGAAGACCCTGGAGTGGG - Intronic
1089120705 11:116132669-116132691 GAGGGTGAAGGACCTGAAGCAGG - Intergenic
1090431237 11:126648352-126648374 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1091321632 11:134656333-134656355 TGGGGTGAAGGCCCGGAGGCTGG + Intergenic
1202824263 11_KI270721v1_random:82672-82694 GAGGGTGAAGCCCGTGAGCCTGG - Intergenic
1091587062 12:1822462-1822484 CAGGGTGGTGTCCCTGGGGCTGG - Intronic
1091808936 12:3378919-3378941 CAGGGGCAAGCCCCTGAGTCAGG - Intergenic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1092265543 12:6977803-6977825 CAGGGTGAGGACCCAGAGGCAGG - Intronic
1093441114 12:19197359-19197381 CAGTGTTAAGACCCTGAGGCAGG - Intronic
1094360424 12:29624574-29624596 CAGTGCCAAGTCCCTGAGGCAGG - Intronic
1094449295 12:30567291-30567313 AAGGGCAAAGTCCCTGAGGCTGG - Intergenic
1095181131 12:39147431-39147453 CAGAGAGAAGGCCCAGAGGCTGG - Intergenic
1095961771 12:47839407-47839429 CAGGGTGTGGAGCCTGTGGCTGG - Intergenic
1096480050 12:51934096-51934118 AAGAGTGAAGAACCTGAGGCCGG - Intergenic
1097781145 12:63706616-63706638 AAGGTTAAAGACCCTCAGGCTGG + Intergenic
1098164715 12:67682523-67682545 CAGGATGACAACCTTGAGGCAGG + Intergenic
1098573931 12:72019404-72019426 AAGTGCAAAGACCCTGAGGCAGG - Intronic
1098855632 12:75650289-75650311 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1099277852 12:80600968-80600990 CAGCGTGAAGACCCTGAGGCAGG - Intronic
1099379719 12:81939033-81939055 CAGCATGAAGACCCTGGGTCTGG + Intergenic
1099644067 12:85327879-85327901 CAGAGGTAAGGCCCTGAGGCAGG + Intergenic
1101554956 12:105800317-105800339 CTGTGTGAAGGTCCTGAGGCAGG + Intergenic
1101725655 12:107386104-107386126 CAGGGCAAAGGCCCTGAGGCAGG - Intronic
1101733574 12:107446126-107446148 CAGTGGGAAGGCACTGAGGCAGG + Intronic
1101920140 12:108925739-108925761 CAGTGCAAAGATCCTGAGGCAGG - Intronic
1102396026 12:112586507-112586529 AAGGGTGAAGGCTATGAGGCTGG + Intronic
1102456540 12:113074411-113074433 CAGTGAGAAGGCCCTGAGGCTGG + Intronic
1103201667 12:119092970-119092992 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104030122 12:125058943-125058965 CAGGGCTCAGACCTTGAGGCAGG - Intergenic
1105022677 12:132828060-132828082 AAGTTTGAAGACCCTGAGGGCGG - Intronic
1105210746 13:18255434-18255456 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1105456316 13:20544456-20544478 CAGGGTGGAGAACTTGAGCCAGG + Intergenic
1106758666 13:32846792-32846814 CTGGGGGGAGACCGTGAGGCAGG + Intergenic
1107446062 13:40471390-40471412 AAGAGTGAACACCCTGAGCCAGG + Intergenic
1108622931 13:52201663-52201685 TAAGCTGAAGGCCCTGAGGCAGG - Intergenic
1108663797 13:52609380-52609402 TAAGCTGAAGGCCCTGAGGCAGG + Intergenic
1108841721 13:54626094-54626116 GAGGGCAAAGACCCTGAGACAGG + Intergenic
1109622325 13:64925891-64925913 CAGGGTGAGAACCGCGAGGCGGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112254397 13:97816335-97816357 CAGGTTGAAATCCCTGAGGAGGG + Intergenic
1113037040 13:106062007-106062029 CAGGGAGCACAGCCTGAGGCAGG - Intergenic
1113267750 13:108638208-108638230 AAGTTCGAAGACCCTGAGGCAGG + Intronic
1116774931 14:49168066-49168088 AAGTGGGAAGATCCTGAGGCTGG + Intergenic
1117575967 14:57098091-57098113 CAGTTGCAAGACCCTGAGGCTGG - Intergenic
1121497404 14:94403423-94403445 CATGTTGAAGACCTTGAGGAGGG + Intergenic
1121824218 14:96997492-96997514 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1122283298 14:100636814-100636836 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1122307610 14:100775803-100775825 CAGGGTCAAGACCCTGGAGCTGG + Intergenic
1122630845 14:103107152-103107174 CTGGGTGAGGACCCTGGGCCTGG - Intronic
1122787038 14:104168618-104168640 CGGGGTGGAGACCCAGAGTCAGG - Intronic
1123059566 14:105588363-105588385 CAGCGGGAAGACCTTGGGGCTGG + Intergenic
1123083904 14:105708633-105708655 CAGCGGGAAGACCTTGGGGCTGG + Intergenic
1123450488 15:20356806-20356828 CAGGGCGAAGGCCCGGAGGAGGG - Intergenic
1124142873 15:27092882-27092904 CAAGGAGAAGACCCTGTGGATGG - Intronic
1125717268 15:41826486-41826508 CAGGGTGGTGAAGCTGAGGCAGG - Exonic
1125892712 15:43278101-43278123 CTGGGTGAAAACCCTGGGGTAGG + Intronic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1128634422 15:69294033-69294055 CAGGGGGAAGATGCTGAGACAGG - Intergenic
1128746962 15:70121419-70121441 CAGTGTGAAGGCCCTCAGGGAGG - Intergenic
1129102840 15:73282105-73282127 AAGGGAAAGGACCCTGAGGCAGG - Intronic
1129237781 15:74234154-74234176 GAGGGGCAAGCCCCTGAGGCTGG - Intergenic
1129361578 15:75027866-75027888 CAAGGTGAAGGTCCTGAGGAGGG - Intronic
1129999021 15:80031425-80031447 GAGTGTGAAGACTCTGAGGCAGG + Intergenic
1130353512 15:83110625-83110647 AATGGTGAACAGCCTGAGGCAGG - Intronic
1130562885 15:84972337-84972359 CAGGGTGAAGACCCAAACCCAGG - Intergenic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1131451007 15:92539906-92539928 CAGTGCCAAGGCCCTGAGGCAGG + Intergenic
1132502752 16:291864-291886 CGGAGTGAAGGCCCAGAGGCAGG - Intronic
1132836964 16:1958994-1959016 CAGGGAGCAGACCAGGAGGCAGG - Intergenic
1132981630 16:2741202-2741224 AGGGCTGCAGACCCTGAGGCAGG - Intergenic
1133440645 16:5818276-5818298 CAGGGTGAAGACCATTACCCCGG + Intergenic
1133901482 16:9979388-9979410 CAGTGCGAAGACACTGAGGAGGG - Intronic
1134255052 16:12603579-12603601 TAGGGAGAAGGCACTGAGGCAGG + Intergenic
1134572982 16:15307408-15307430 CAGTTTGAAGGCCCTCAGGCAGG - Intergenic
1134729402 16:16448574-16448596 CAGCTTGAAGGCCCTCAGGCAGG + Intergenic
1134938033 16:18263276-18263298 CAGTTTGAAGGCCCTCAGGCAGG - Intergenic
1135964050 16:27021355-27021377 GCGGGTGAAGACTCTGAGGCTGG - Intergenic
1136036100 16:27541754-27541776 CAGAGTGAAGAAACTGAGGTCGG + Intronic
1136097268 16:27966053-27966075 CAGTGCGAAGGCCCTGAGGCAGG - Intronic
1136157786 16:28396239-28396261 TAGGGTGAGGAAACTGAGGCAGG + Intronic
1136205301 16:28719045-28719067 TAGGGTGAGGAAACTGAGGCAGG - Intronic
1136778438 16:32883534-32883556 AAGGGGGCAGTCCCTGAGGCTGG + Intergenic
1136892182 16:33977980-33978002 AAGGGGGCAGTCCCTGAGGCTGG - Intergenic
1137409008 16:48212196-48212218 AAGTGTGAAAGCCCTGAGGCTGG - Intronic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1138681169 16:58684518-58684540 CTGGGTGGAGACCCTCTGGCTGG + Exonic
1139334731 16:66223801-66223823 AAGGGTGAAAGCCCTGAGGTGGG + Intergenic
1140410239 16:74736793-74736815 CATGAATAAGACCCTGAGGCCGG - Intronic
1140876629 16:79158615-79158637 GAAGGTGAAGGCCCTGAGGCGGG - Intronic
1141112157 16:81278702-81278724 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1141242614 16:82277125-82277147 CAGTCTGAAGATCCTCAGGCAGG + Intergenic
1141364080 16:83426197-83426219 TAGGGTGGAAACCCAGAGGCTGG - Intronic
1141848788 16:86629956-86629978 CAGTGTGAAGGCCCTGAGGCAGG + Intergenic
1142006696 16:87692651-87692673 CAGGGTAAAGTCCCTTAGGATGG + Intronic
1203080860 16_KI270728v1_random:1145643-1145665 AAGGGGGCAGTCCCTGAGGCTGG + Intergenic
1142969966 17:3604689-3604711 CGGGGTCAAGGCCCAGAGGCAGG + Intergenic
1143471133 17:7176962-7176984 CAGGGTGAGGGCGCTGGGGCGGG - Exonic
1143845311 17:9769241-9769263 GAGAGTGAGGACTCTGAGGCAGG - Intergenic
1145252196 17:21302790-21302812 CTGGGTGGGGAGCCTGAGGCAGG - Intronic
1145787814 17:27605431-27605453 CAGGCTGAGGAGCCAGAGGCTGG + Exonic
1146532466 17:33620977-33620999 CAAGGATAAGACCCTGAGACAGG - Intronic
1147845088 17:43399284-43399306 TAGGGTGCAGACGCTGAGACCGG - Intronic
1147911444 17:43858490-43858512 CAGGGTCAGGAGCCTCAGGCAGG - Intronic
1148002980 17:44400977-44400999 GAGGATGAAGACCCTCAGGATGG - Exonic
1150149816 17:62799880-62799902 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150805566 17:68316127-68316149 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1151252267 17:72845389-72845411 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1151716422 17:75833276-75833298 AAGGGCAGAGACCCTGAGGCAGG - Intronic
1151923178 17:77173297-77173319 CTGGGGGAGGGCCCTGAGGCTGG + Intronic
1152296884 17:79472666-79472688 CATGGTGAAGCCCCTCAGCCTGG - Intronic
1152555699 17:81052166-81052188 CAGGGCAAAGGCCCCGAGGCAGG - Intronic
1152803173 17:82341347-82341369 CAGGCTGAGGAAGCTGAGGCTGG - Intergenic
1153300152 18:3585188-3585210 TAGTGGGAAGAACCTGAGGCTGG - Intronic
1154292972 18:13126819-13126841 CAAGGCGAAGCCCGTGAGGCAGG - Intergenic
1155874920 18:31074259-31074281 CAGAAAGCAGACCCTGAGGCAGG - Intronic
1156308732 18:35903929-35903951 CACTGTGAACACCATGAGGCTGG + Intergenic
1157436554 18:47674966-47674988 CAGGGTGTAAACCCAGAGGAGGG - Intergenic
1157967363 18:52223317-52223339 ACAGGTGAAGACTCTGAGGCTGG - Intergenic
1158253432 18:55516725-55516747 AAATGTGAAGACCCTGAGGTGGG + Intronic
1158823366 18:61186830-61186852 CAGGATGAAGATCTAGAGGCAGG - Intergenic
1159367270 18:67484377-67484399 CAGCTTTAAGACACTGAGGCTGG - Intergenic
1160542456 18:79631981-79632003 CAGGATGTAGACTGTGAGGCTGG + Intergenic
1160625634 18:80202717-80202739 CTGGATGAAGACCCTGAGCAGGG + Exonic
1160802612 19:977271-977293 CTGTGTGAAGGCCCTGAGGCCGG - Intergenic
1161195381 19:2983531-2983553 CTGTGTGAAGGCCCTGAGGCAGG + Intronic
1161246794 19:3257226-3257248 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1161700691 19:5793392-5793414 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161859212 19:6785065-6785087 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1162080701 19:8215971-8215993 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162153636 19:8662454-8662476 CTGTGCAAAGACCCTGAGGCAGG + Intergenic
1162512970 19:11130947-11130969 CTGTGCGAAGGCCCTGAGGCTGG + Intronic
1162518980 19:11167858-11167880 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162528970 19:11224618-11224640 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1162822756 19:13233175-13233197 CTGTGTAAAGGCCCTGAGGCAGG - Intronic
1162871645 19:13591031-13591053 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1163090315 19:15014860-15014882 AAGGGAGAAGCCCCTGAGGATGG + Intronic
1163272975 19:16265401-16265423 CAGTGCCAAGACCCTGAGGCAGG + Intergenic
1163780418 19:19244238-19244260 CAGTGTGAAGGCTCAGAGGCAGG - Intronic
1163913295 19:20215578-20215600 CATGGTGAAGTCACTGAGGGTGG + Intergenic
1163914823 19:20231885-20231907 CATGGTGAAGTTCCTGAGGGGGG + Intergenic
1163920891 19:20287476-20287498 CATGGTGAAGTTCCTGAGGGTGG - Intergenic
1163957550 19:20658379-20658401 CATGGTGAAGTTCCTGAGGGTGG + Intronic
1164572254 19:29382996-29383018 CAGAGAGAAAACCCTGAGGCTGG - Intergenic
1165735748 19:38174376-38174398 CAGGGTGAAGGCCAAGTGGCTGG + Intronic
1165791972 19:38498091-38498113 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1166946904 19:46402952-46402974 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1166952482 19:46438803-46438825 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1166952677 19:46440217-46440239 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1167259453 19:48450322-48450344 CTGGGTGAAGAGCCTGTGGCTGG + Exonic
1167906096 19:52661937-52661959 CCAGGTGAAGGCCCTGAGACAGG + Intronic
1167970079 19:53183782-53183804 CCATGTGAAGGCCCTGAGGCAGG + Intronic
1168121119 19:54253165-54253187 CAGGCTGAGGAGCCTGGGGCAGG - Intronic
925118770 2:1401702-1401724 CTGGCAGAAGACACTGAGGCAGG - Intronic
925134084 2:1514514-1514536 CAAGGGGGAGTCCCTGAGGCTGG - Intronic
926141127 2:10369122-10369144 CAGGCTGAAAACCCTGTGCCGGG + Exonic
926172036 2:10558606-10558628 CAGTGTGAGGAAACTGAGGCAGG + Intergenic
926226870 2:10973022-10973044 AAGTGTGAAGGCTCTGAGGCAGG + Intergenic
928194140 2:29202160-29202182 CAGTGTGAACAGCCAGAGGCAGG - Intronic
928314151 2:30232761-30232783 CAGGGTGAAGAGTCTGACGTAGG - Intronic
928586288 2:32761600-32761622 CAAGAGGAAGACCCTGAGGCAGG - Intronic
929852442 2:45604604-45604626 AAGTGCAAAGACCCTGAGGCAGG - Intronic
931890184 2:66662470-66662492 CAGAGGGAAGGCCCTGAGGATGG - Intergenic
932017276 2:68043951-68043973 CAGGGCAAAGACCCCAAGGCAGG - Intronic
932579928 2:72986463-72986485 CAGGGTCAGGACCATGAGCCTGG + Intronic
932732510 2:74231272-74231294 CAGGATGAAGACGATGATGCCGG + Exonic
932854797 2:75221843-75221865 CAGGATGGAGACCCAGAGGGAGG - Intergenic
933755212 2:85633026-85633048 CAAGGTGTAGATCCTGAGGGAGG + Intronic
933943977 2:87268360-87268382 AAGGATGTAGACCCTGAGTCTGG + Intergenic
934657002 2:96121630-96121652 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935692892 2:105745744-105745766 CAGGGCGCAGAGCCTGAAGCCGG - Intronic
935794775 2:106630589-106630611 AAGGCTGAAGACCCTGGAGCTGG + Intergenic
935975760 2:108576892-108576914 CAGGGAGAACTCCCTGAGGTAGG + Intronic
936336243 2:111593219-111593241 AAGGATGTAGACCCTGAGTCTGG - Intergenic
937060324 2:118976044-118976066 CAGAGTGGAGCCACTGAGGCTGG + Intronic
937164001 2:119795076-119795098 CAGAGAGGAGACCCTGAGGTGGG + Intronic
937205739 2:120236122-120236144 GGGTGTGAGGACCCTGAGGCTGG + Intergenic
937291960 2:120787264-120787286 GGGGGTGCAGATCCTGAGGCAGG + Intronic
937434590 2:121869968-121869990 CAGGGTGAAGACCTCAAGGCTGG - Intergenic
937466155 2:122134908-122134930 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
937985284 2:127635558-127635580 CAGGGGAATGACCCTGAGTCAGG - Intronic
940908718 2:159191479-159191501 GGGGGTAAAGACCATGAGGCCGG + Intronic
944668545 2:201976381-201976403 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
944968240 2:204960993-204961015 AAGTGCAAAGACCCTGAGGCAGG + Intronic
945430205 2:209755098-209755120 GAGGGTGCAGACCCTGGGGAAGG + Intergenic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
946356333 2:219187853-219187875 AAGGGGGAAGTCTCTGAGGCTGG + Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948250427 2:236524086-236524108 CAGGGTCAAGACCTTCATGCTGG - Intergenic
948446778 2:238039362-238039384 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
948695243 2:239729891-239729913 CAGGGTGGAACCCCTGAGCCAGG - Intergenic
948730065 2:239957155-239957177 CAGGTGGAAGCCCCTGATGCAGG - Intronic
948790741 2:240375423-240375445 CAGGGTAAAGCCGCTGAGTCAGG + Intergenic
948793948 2:240392688-240392710 AGGGGTGAGGACCCTGAGTCTGG - Intergenic
949000576 2:241610601-241610623 CCGGGAGAAGACCCCGTGGCTGG - Intronic
1168971250 20:1932424-1932446 CAGTGCCAAGACCCTGAGACGGG + Intronic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1170594132 20:17792741-17792763 CATGGTGGAGATACTGAGGCAGG + Intergenic
1170894728 20:20402979-20403001 CAGGTGGAAGGGCCTGAGGCAGG - Intronic
1171106184 20:22434930-22434952 CAGGGTGCAGCCCTCGAGGCAGG - Intergenic
1171250012 20:23639677-23639699 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171266755 20:23777401-23777423 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171276301 20:23859045-23859067 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171291888 20:23987123-23987145 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1171956551 20:31468243-31468265 AAGGGCCAAGGCCCTGAGGCAGG - Intronic
1172027047 20:31955614-31955636 CAGTGGAAAGACCCTGAGGCAGG - Intergenic
1172307940 20:33894923-33894945 CAGAGTGAAGGGCCTGAGTCTGG + Intergenic
1172619386 20:36309066-36309088 ATGTGTGAAGACCCTGAAGCTGG - Intronic
1172757246 20:37294568-37294590 AAGGGCCAAGTCCCTGAGGCAGG - Intronic
1172767710 20:37359569-37359591 CAGTGGGGAGACCCCGAGGCAGG + Intronic
1173190919 20:40875082-40875104 CAGGGAGAAGTCCCTGGGGCTGG - Intergenic
1173693281 20:44983067-44983089 CAGTGCAAAGACCTTGAGGCTGG + Intronic
1173861609 20:46287522-46287544 CTGGGTAGAGGCCCTGAGGCTGG + Intronic
1174117614 20:48237992-48238014 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
1174121482 20:48268924-48268946 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
1174122236 20:48274710-48274732 CAGGGAAAAGACCTTGAAGCAGG - Intergenic
1174156824 20:48521186-48521208 CATGGTGAACATCCAGAGGCCGG - Intergenic
1174360899 20:50028376-50028398 CAGTGCAAAGGCCCTGAGGCTGG - Intergenic
1174361098 20:50029476-50029498 CAGTGTGAAGGCCCTGAGGCAGG + Intergenic
1174397687 20:50258056-50258078 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1174416271 20:50369412-50369434 CAAGGTGGAGAAACTGAGGCAGG + Intergenic
1174447968 20:50602911-50602933 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174466695 20:50723295-50723317 CAAGGTGAGGACAGTGAGGCAGG - Intergenic
1174706996 20:52667355-52667377 CTGATTGTAGACCCTGAGGCTGG + Intergenic
1175246011 20:57582321-57582343 CAAAGTGAAGACCCTGGGACAGG - Intergenic
1175271314 20:57736046-57736068 CAGGGTGTGAAACCTGAGGCAGG - Intergenic
1175384445 20:58585192-58585214 CAGTGCCAAGGCCCTGAGGCAGG + Intergenic
1175502452 20:59460156-59460178 CAGGGAGAAGAGACTGAGGTTGG + Intergenic
1175751816 20:61503930-61503952 CAGGGAGAAGAACATGAGCCAGG + Intronic
1175815907 20:61883114-61883136 CAGCGAGAAGGCCCTGGGGCAGG - Intronic
1176045623 20:63091197-63091219 CTGGCTGATGGCCCTGAGGCTGG + Intergenic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1179149909 21:38800973-38800995 CAGGTTGAAGAACCAGAGGAGGG - Intergenic
1179197850 21:39182997-39183019 CAGGGTGAAGCCGCTGTGGGAGG - Intronic
1179637538 21:42723040-42723062 CCGTGTGAACACCATGAGGCAGG + Intronic
1180765509 22:18343983-18344005 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1180780808 22:18518409-18518431 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1180813521 22:18775716-18775738 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181010887 22:20039987-20040009 CACGGTGAGGTCCCTGAGGATGG - Intronic
1181086744 22:20443370-20443392 AAGGGTGCAGACCCTGAGATGGG + Intronic
1181199705 22:21210046-21210068 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1181400057 22:22645812-22645834 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181423330 22:22817145-22817167 CAGGATGCAGTCGCTGAGGCTGG - Intronic
1181649307 22:24249978-24250000 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181673446 22:24436855-24436877 CTGGGACAAGACCCTGAGGAAGG + Intronic
1181702031 22:24626910-24626932 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181770214 22:25119780-25119802 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181790403 22:25261102-25261124 CAGGCTGTAGACCCCGAGGTTGG + Intergenic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1181836665 22:25615936-25615958 CAGGGCAAAGACCCTAAGGCTGG + Intronic
1182101885 22:27663228-27663250 CAGGGTGAAGGCCTGGAGGCTGG - Intergenic
1182567388 22:31210539-31210561 GCTGGTGAAGACCATGAGGCTGG + Intergenic
1183030281 22:35098789-35098811 CAGTGCCAAGACCCTGAGGCAGG - Intergenic
1183560759 22:38570561-38570583 CCGGGAGAAGACCCTGAGGCGGG + Intergenic
1183598553 22:38826735-38826757 TAGGCTGAGGACCCTGAGGGTGG + Exonic
1183686290 22:39363130-39363152 GAGTGTGAATGCCCTGAGGCAGG + Intronic
1183950540 22:41350176-41350198 CAGACTGAAGTCTCTGAGGCAGG + Intronic
1184060631 22:42079120-42079142 CAGGGGGAAGACGCAGAGGCCGG + Exonic
1184272759 22:43394021-43394043 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1184466886 22:44673750-44673772 CAGGGAGAAGATCCTGAGCGTGG + Intronic
1184727864 22:46356877-46356899 CAGCGGGAAGATCCTGCGGCTGG + Exonic
1185195978 22:49469854-49469876 CATGGTAAAGACCCTGGGGGAGG + Intronic
1203227130 22_KI270731v1_random:84873-84895 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1203263621 22_KI270734v1_random:1398-1420 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950634803 3:14307329-14307351 CAGGGTGAAATCGGTGAGGCCGG + Intergenic
950640863 3:14347173-14347195 CAGTGTAAAGGCCCTGAGGTGGG + Intergenic
951109827 3:18789849-18789871 AAGTGCGAAGTCCCTGAGGCAGG + Intergenic
951414541 3:22407996-22408018 CAGGGAGAAGACTTTGAGGTGGG + Intergenic
951992596 3:28692154-28692176 CAGGGTGAACACGCTTCGGCAGG - Intergenic
952847379 3:37699804-37699826 CAGTGTCAACGCCCTGAGGCAGG - Intronic
955507935 3:59650694-59650716 CAGTGCAAAGACCCTGAAGCAGG + Intergenic
956823314 3:72973311-72973333 CAGGGGAAAGTCCCGGAGGCAGG + Intronic
958968965 3:100590243-100590265 GTAGGTGAAGACCCTGAGACTGG + Intergenic
959153653 3:102639524-102639546 AAATGTGAAGACCCTGAGACAGG + Intergenic
960616770 3:119602953-119602975 CCGGGCAAAGACCCTCAGGCAGG + Intronic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
962095446 3:132287968-132287990 AAGTGTAAAAACCCTGAGGCAGG - Intergenic
962457126 3:135574881-135574903 AAGGGTGAAGACACTGTGGAAGG - Intergenic
962465026 3:135649754-135649776 CAGAGGGAAGACGCTGAAGCTGG - Intergenic
962600858 3:136989989-136990011 CAGGGTGAAGAGGTAGAGGCAGG + Intronic
962823075 3:139071493-139071515 CAGGGTGGAAACCATGAGTCAGG + Intronic
962946986 3:140180928-140180950 CATGAACAAGACCCTGAGGCAGG - Intronic
964869770 3:161300717-161300739 CACTGTAAAGACCCTGATGCAGG - Intergenic
965537219 3:169835822-169835844 CAGTGTTAAGGCCCTGAGCCAGG - Intronic
965837852 3:172870906-172870928 CAGGGTGTAGACCCTGTGTTAGG + Intergenic
966890058 3:184400728-184400750 CTGGATGAAGACCCAGAGGCTGG + Intronic
967741570 3:193008850-193008872 AAGTGCAAAGACCCTGAGGCTGG - Intergenic
968623133 4:1613316-1613338 CAGGGTGAGGACCCGGTGACAGG - Intergenic
968957522 4:3726847-3726869 CAGTGTGGGGACCCTGCGGCAGG + Intergenic
969083260 4:4636582-4636604 AAGTGCGAAGACCCTGAGGTGGG + Intergenic
970458297 4:16247350-16247372 CAGGAAGTAGAGCCTGAGGCAGG + Intergenic
970801362 4:19976673-19976695 CAGGATGAGGACCCTGGGCCTGG + Intergenic
971372287 4:26028840-26028862 CAGGGTGAATCCCCCGAGGTCGG - Intergenic
972054362 4:34780932-34780954 GAGGGTGAAAACCCTAAGCCTGG - Intergenic
973187313 4:47345522-47345544 CAAGTTGAAGACCCTGTGGTAGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977789096 4:101077021-101077043 CAGAGTGAAGACACAGAGGCAGG + Intronic
978219701 4:106256002-106256024 CAGAGAGAAGACCCTGGGGTGGG + Intronic
981903218 4:149890700-149890722 CAGTGGGGAGACTCTGAGGCTGG - Intergenic
986462207 5:7983661-7983683 CTGGGTGGAGCCCCCGAGGCGGG + Intergenic
986575508 5:9208635-9208657 CTGGGAGAAGACCATAAGGCTGG + Intronic
986746919 5:10753217-10753239 CACGGAGTAGATCCTGAGGCAGG + Intronic
986751858 5:10794706-10794728 CAAGCTGGAGACCCTGAGACAGG + Intergenic
987039892 5:14052574-14052596 AAGGGCAAAGGCCCTGAGGCGGG + Intergenic
988371256 5:30370946-30370968 AAAGGTGAAGGCCCAGAGGCTGG - Intergenic
988865947 5:35335241-35335263 AAGGGCAAAGACCCTGAGGTGGG - Intergenic
990056755 5:51591160-51591182 CAGTGTGAAGACTCTAGGGCAGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
990978141 5:61576979-61577001 CTAGATGGAGACCCTGAGGCGGG + Intergenic
991489299 5:67166744-67166766 CAGGGTGGAGACCCGGAAGGAGG - Exonic
991512775 5:67398089-67398111 CAGGGTTGAGATGCTGAGGCAGG - Intergenic
992380229 5:76229196-76229218 CAGGGTGAGGATCCTCAGCCTGG - Intronic
992745522 5:79816486-79816508 TATGCTGAAGACCCTTAGGCTGG + Intergenic
992940947 5:81760725-81760747 CAAGGCAAAGGCCCTGAGGCTGG - Intergenic
994128440 5:96196614-96196636 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
995238374 5:109857143-109857165 AAGTGTGAAGGCCCTGAGGCCGG + Intronic
995336372 5:111004528-111004550 AAGGGTGAAAAGCCTGGGGCCGG - Intergenic
996339718 5:122423082-122423104 CAGGGCCAAGCTCCTGAGGCTGG - Exonic
996377941 5:122834890-122834912 CAGGGTCAAGATCTTGTGGCTGG + Intergenic
996570149 5:124924891-124924913 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
996628066 5:125594295-125594317 CAAGGCAAAGGCCCTGAGGCAGG + Intergenic
998372750 5:141671927-141671949 CAAGGTGCAGAGCCTGAAGCTGG - Exonic
998835236 5:146196857-146196879 AAGTGCAAAGACCCTGAGGCAGG - Intergenic
999127359 5:149255669-149255691 CAGTGTTGAGACCCTGATGCAGG + Intronic
999427606 5:151501066-151501088 CAGGGGCAAGACCCCAAGGCAGG - Intergenic
1001483064 5:172101848-172101870 CAGTGCCAAGGCCCTGAGGCAGG + Intronic
1001569254 5:172719381-172719403 GAGGGTGTAGTCCCTGAAGCTGG + Intergenic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1001677132 5:173528261-173528283 CAGGGTGAAGCCACTGGGCCTGG - Intergenic
1002166579 5:177351433-177351455 CAAGGTGAAGCCCTTGGGGCGGG - Exonic
1002419017 5:179135890-179135912 CAGGGTGAGTACACAGAGGCCGG - Exonic
1002605509 5:180380664-180380686 CAGGGTGAAGCCCGACAGGCTGG + Intergenic
1003204072 6:3991154-3991176 GAGGGTGAAGGTTCTGAGGCAGG + Intergenic
1003250986 6:4429049-4429071 CAGGGCCAAGACCCTGAAGGGGG - Intergenic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1003587639 6:7407594-7407616 CAGGCTGAAGCAGCTGAGGCAGG - Intronic
1004110882 6:12717511-12717533 GAGGGTGCAGAGGCTGAGGCTGG + Exonic
1005214702 6:23511624-23511646 CAGGGCGAAGACCCTGAAATGGG - Intergenic
1006452631 6:34113974-34113996 CAGTGCAAAGACCCTGAAGCAGG - Intronic
1006519051 6:34561047-34561069 AGGCGTGAAGAGCCTGAGGCTGG + Intergenic
1006744572 6:36332199-36332221 CAGTGTGAAGGGCCTGAGGCAGG - Intronic
1007112841 6:39322938-39322960 AAGGGTGAAGACGCTGGGGGCGG - Intronic
1007116111 6:39344529-39344551 CAGAGCAAAGGCCCTGAGGCTGG - Intronic
1007421277 6:41721083-41721105 CTGGGTGATGACCCTGTGTCAGG - Intronic
1007621427 6:43217349-43217371 GAGCAAGAAGACCCTGAGGCAGG - Intronic
1007726739 6:43921343-43921365 CAGGGAGAAGGCACAGAGGCGGG + Intergenic
1010345603 6:74806545-74806567 GAGTGTGAACACCCGGAGGCAGG - Intergenic
1014662801 6:124193973-124193995 CAGAGAGAAGACCCTGGAGCCGG + Intronic
1015143330 6:129959035-129959057 CAGAGAGGAGACCCTGAGGTGGG - Intergenic
1016015098 6:139175826-139175848 CATGGTGAATACCAAGAGGCTGG - Intronic
1016307207 6:142696805-142696827 CAGGGTAAACAACCTGGGGCAGG - Intergenic
1017209036 6:151834781-151834803 CAGGGAGAAGGCGCTGAGACAGG + Intronic
1017816301 6:158018947-158018969 CATGGTGATGACCGTGAGGATGG + Intronic
1018450475 6:163902757-163902779 CAGTGTGAAGGCCCTGAAGGTGG + Intergenic
1019093223 6:169557397-169557419 CGTGGGGAAGACCCTGAGGTGGG + Intronic
1019101956 6:169638811-169638833 GAGGCTGCAGAGCCTGAGGCAGG + Intronic
1020290893 7:6721524-6721546 CAGGAAGAAGAACCTGAGGCGGG - Intergenic
1022315148 7:29238810-29238832 CAGGACAAAGACCCTGAGGTGGG + Intronic
1022329758 7:29366410-29366432 AAGGGTGAAGACCAGGAGGGTGG + Intronic
1022401371 7:30041529-30041551 CAAGGTGATGCACCTGAGGCAGG - Intronic
1022926423 7:35059560-35059582 CCAGGAGAAGCCCCTGAGGCAGG - Intergenic
1022939728 7:35222679-35222701 AAGGTTAAAGACCCTCAGGCTGG + Intronic
1023019119 7:35994579-35994601 CTAGCTGAAGACCCTGAGTCTGG - Intergenic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1023138828 7:37080843-37080865 CAATGTGAAGACCCTGAGGCAGG - Intronic
1023459539 7:40380041-40380063 CAGTGGGAGAACCCTGAGGCAGG + Intronic
1024167431 7:46748779-46748801 GAGGGCAAAGACCCTGAAGCAGG - Intronic
1024968179 7:55043937-55043959 CAGGTTGAACAAGCTGAGGCAGG - Intronic
1025091431 7:56067424-56067446 CAGGGTGCAGAGGCTAAGGCAGG - Intronic
1025202065 7:56968546-56968568 AAGGGTGAGGAGCCAGAGGCAGG - Intergenic
1025247893 7:57331201-57331223 CAGCGCAAAGGCCCTGAGGCAGG - Intergenic
1025254352 7:57373333-57373355 CAAGGTGGAGAAACTGAGGCAGG - Intergenic
1025669882 7:63608382-63608404 AAGGGTGAGGAGCCAGAGGCAGG + Intergenic
1025903648 7:65767416-65767438 CAGGGTGCAGAAGCTAAGGCAGG - Intergenic
1026152997 7:67803834-67803856 CAGGGTGAAGACTCCAGGGCAGG + Intergenic
1029170785 7:98627809-98627831 CAGGGTTAAGACCCTGAGCAGGG - Intronic
1029513476 7:101011230-101011252 CAGGGTGCCGACGCTGAGCCAGG - Intronic
1029824426 7:103174245-103174267 CCAGGAGAAGCCCCTGAGGCAGG - Intergenic
1030112451 7:106038423-106038445 CAGAGTGATGAGCATGAGGCTGG + Intergenic
1030813106 7:114000830-114000852 CAGGGTTGAGAACCTGAGTCAGG - Intronic
1031987327 7:128171623-128171645 GAGGGTGAAGTCCGTGAGACTGG + Intergenic
1032154879 7:129459559-129459581 GAGTGTGAAGACCCTAAAGCAGG + Exonic
1032513757 7:132492158-132492180 CAGGGTGGGGACACTGAGGCAGG + Intronic
1032663503 7:134011977-134011999 AAGGGTGAAGAGCCAGAGGGAGG + Intronic
1033302877 7:140201894-140201916 AAAGATGAAGACTCTGAGGCTGG - Intergenic
1033908666 7:146238400-146238422 CAATGTGAAGAGCCTGAGGTTGG + Intronic
1034489864 7:151387423-151387445 CAGGCTGAGGACCCTGGGGCTGG - Intronic
1034553046 7:151833292-151833314 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1035360807 7:158313249-158313271 CAGGAGGACGACCCTGTGGCAGG - Intronic
1035831288 8:2697187-2697209 CAGTGGGAAGACCCCAAGGCTGG - Intergenic
1037404691 8:18529117-18529139 CTGGGTGAAGTCCCAGAAGCTGG - Exonic
1037520286 8:19674444-19674466 AAGGAAAAAGACCCTGAGGCAGG + Intronic
1037825039 8:22155850-22155872 CAAGGGGGAGCCCCTGAGGCTGG + Intronic
1037954287 8:23042135-23042157 CAGGGTCAAGACCAGGAAGCAGG - Intronic
1038454101 8:27660978-27661000 CAGTTTGAAGACCATCAGGCAGG + Intronic
1038861513 8:31393426-31393448 CAGGTACAAGACCCTGAGGTAGG + Intergenic
1040516851 8:48142824-48142846 CAGTGCGAAGGCCCTGTGGCAGG + Intergenic
1040998078 8:53421842-53421864 CAGGGGGAAGCCAGTGAGGCAGG - Intergenic
1041945255 8:63433658-63433680 TGGGTTGAAGACCCTGAGGGAGG + Intergenic
1042864250 8:73343781-73343803 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1044865157 8:96563634-96563656 CAAGGTGCAGTCCCTGGGGCCGG - Intronic
1045181003 8:99782593-99782615 CAGAGGGAAGGCTCTGAGGCAGG + Intronic
1046345678 8:112923474-112923496 AAGTGTAAAGACCCTGAGGGAGG - Intronic
1049015065 8:139914295-139914317 CAGGGAGACGACCCGCAGGCAGG + Intronic
1049325847 8:142021061-142021083 GAGGGTGTGAACCCTGAGGCCGG - Intergenic
1049467326 8:142757571-142757593 CCGGGAGACCACCCTGAGGCAGG - Intergenic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1050424722 9:5501562-5501584 CAGAGGGAAGACACAGAGGCTGG + Intergenic
1052080780 9:24203287-24203309 CAGCATGAGGACCCTGAGCCTGG - Intergenic
1052779351 9:32764896-32764918 CAGAAGCAAGACCCTGAGGCAGG + Intergenic
1053355426 9:37441599-37441621 CAGTGTGAAAACCCTGAGGTTGG - Exonic
1054740821 9:68804223-68804245 CAGGGTGAAGAGCCAGATGAGGG + Intronic
1055874379 9:80924561-80924583 CTGGGCAAAGGCCCTGAGGCAGG + Intergenic
1056277366 9:85006479-85006501 CAGGGTGAGGAGCCTCAGGATGG - Intronic
1056445708 9:86664822-86664844 CAGGATGAAGCTCCTGAGGTTGG - Intergenic
1057222916 9:93267462-93267484 CTGGTTACAGACCCTGAGGCCGG - Intronic
1057468318 9:95336518-95336540 CTGGGTGAAGACCGTGAAGCTGG - Intergenic
1057530181 9:95838166-95838188 CAGGGTGGAGACAGTGAGACAGG - Intergenic
1057794104 9:98143401-98143423 CAGGGTGGAGACTGGGAGGCAGG + Intronic
1058903337 9:109460591-109460613 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1058950073 9:109895029-109895051 AGAGGTGAAGAACCTGAGGCCGG + Intronic
1059300801 9:113311619-113311641 CACGATGAAGCTCCTGAGGCTGG - Intergenic
1060490651 9:124081752-124081774 CAGGATGGAGAGCCTGAAGCAGG - Intergenic
1061972085 9:134050355-134050377 CAAGGTGAGCACCCTGAGTCCGG - Exonic
1062029443 9:134355648-134355670 CAGGCTGAGGACCCAGAGGCCGG + Intronic
1203787523 EBV:136276-136298 CCGCGTGGAGACTCTGAGGCAGG + Intergenic
1186477154 X:9866489-9866511 CAAGCTGAAAACCCTGCGGCAGG + Intronic
1186501415 X:10053699-10053721 CAGATTGAAGACTCTGAGGCTGG + Intronic
1186515581 X:10164250-10164272 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1186892385 X:13971772-13971794 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1187160589 X:16761559-16761581 CAAGGTGAGGAGGCTGAGGCAGG + Exonic
1188111329 X:26198540-26198562 CAGGGCGAGGACCATGAGGAAGG + Intergenic
1188113115 X:26215473-26215495 CAAGGTGAGGACCCTGAGTAAGG + Intergenic
1188440958 X:30215185-30215207 CAAGGTGAGGACTCTGAGGGCGG + Intergenic
1188768655 X:34126692-34126714 CAGGGGGAAAACACAGAGGCTGG - Intergenic
1189091758 X:38090867-38090889 CAGTGTGGAGCCCCTGAGGTGGG + Intronic
1190816422 X:53933968-53933990 CAGGGGGCAGACCATGAGGTCGG - Intergenic
1191823518 X:65339243-65339265 CAGAGGGAAGACACTGAAGCTGG + Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1193083726 X:77429618-77429640 CAGAGAGAAGACACTCAGGCAGG + Intergenic
1193221256 X:78929254-78929276 CAGCATGAAGACCCTGGGCCCGG + Intergenic
1193300258 X:79881056-79881078 CAGAGTGAAGAAACTGAGGGTGG + Intergenic
1195287739 X:103401651-103401673 CAAGGTGAAGAACCTGGAGCTGG + Intergenic
1195706763 X:107742988-107743010 CAGGGAGAGGGCCCTGTGGCCGG + Intronic
1196788590 X:119443855-119443877 GAGGGAGTAGATCCTGAGGCAGG - Intronic
1198789457 X:140327758-140327780 AAGTGTGAAGACCCGGAGGCAGG + Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199607100 X:149586110-149586132 CAGGGCCAGGACCCTGAGGGAGG - Intronic
1199632022 X:149783258-149783280 CAGGGCCAGGACCCTGAGGGAGG + Intronic
1200052791 X:153443835-153443857 CAGGGTGGGGCCCCTGAGGCAGG + Intergenic
1200100016 X:153685627-153685649 CAGGGGGAACGCCCCGAGGCTGG + Intronic
1200101391 X:153690522-153690544 AAGGGGGCAGTCCCTGAGGCTGG - Intronic
1200404004 Y:2790182-2790204 CAGGGTGAAGCGGCTGAAGCTGG - Intergenic
1201796936 Y:17906049-17906071 CAGAGTGAAGACCCTGGAGTGGG - Intergenic
1201804617 Y:17999936-17999958 CAGAGTGAAGACCCTGGAGTGGG + Intergenic
1202358312 Y:24075108-24075130 CAGAGTGAAGACCCTGGAGTGGG - Intergenic
1202512466 Y:25595005-25595027 CAGAGTGAAGACCCTGGAGTGGG + Intergenic