ID: 1170187559

View in Genome Browser
Species Human (GRCh38)
Location 20:13608025-13608047
Sequence TCTCAGCTTTAGAAGGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170187559 Original CRISPR TCTCAGCTTTAGAAGGTTAA AGG (reversed) Intronic
901714215 1:11140199-11140221 TCTCAGCTTTCTCAGGTTAAGGG + Intronic
902905128 1:19550899-19550921 TCTCAGCTTATGAAGGTAACAGG + Intergenic
903459544 1:23510817-23510839 TTTCAGTTTTACAAGGTGAAAGG + Intronic
906862554 1:49377337-49377359 TATCAGCTTCAGTAGGTTGATGG - Intronic
907854201 1:58285442-58285464 TATCAGCTTAAGAAGCTTTAGGG - Intronic
908035844 1:60051973-60051995 GCTCAGATTTAGAAAGTTCAAGG - Intronic
908656836 1:66397103-66397125 TCTGAGGGTTAGAAGGTTAATGG + Intergenic
908967295 1:69781330-69781352 TCTGAGCTTTGGAAAGATAATGG - Intronic
910196203 1:84642142-84642164 ACTCAGTTTTAGAAGGAAAACGG - Intergenic
910308058 1:85789437-85789459 TCTCAGCTTAAGAAGCTTTTGGG + Intronic
911467284 1:98271750-98271772 TCTCAGCTTAAGAAGCTTTTGGG + Intergenic
911475839 1:98371276-98371298 TCTCTGCCTTAGAAGGGTAATGG + Intergenic
913211931 1:116589406-116589428 TCTCTGCTTGAAAAGTTTAATGG + Intronic
918977247 1:191505691-191505713 TCTCAGCTTAAGAAGCTGATGGG - Intergenic
919650119 1:200140605-200140627 TCTCAAATTTAAAAGTTTAAAGG - Intronic
921810370 1:219505701-219505723 TCTCAGCTTCTGGAGGTAAACGG - Intergenic
1064599498 10:16978951-16978973 TCTCAGCTTAAGAAGATTTTGGG - Intronic
1065643603 10:27811165-27811187 TCTCTGCTGTTGAAAGTTAAGGG + Intergenic
1066522914 10:36242826-36242848 TATCAGCTTAAGAAGGTTTTGGG - Intergenic
1067464121 10:46482357-46482379 TCACAGCTTTATAACCTTAAAGG - Intergenic
1067623074 10:47902294-47902316 TCACAGCTTTATAACCTTAAAGG + Intergenic
1068087503 10:52392867-52392889 TCTGAGCTCTAGCAGGGTAATGG + Intergenic
1068346331 10:55783704-55783726 TCCCAACTTTAGAAGTTAAAAGG - Intergenic
1068586973 10:58810616-58810638 TCTGAGCTATAGAAGAATAAAGG - Intronic
1069150677 10:64954952-64954974 TATCAGCTTAAGAAGGTTTTGGG - Intergenic
1074445765 10:113519933-113519955 TCCCAGCTTTTGTGGGTTAAGGG + Intergenic
1075206010 10:120449292-120449314 TATCAGCTTAAGGAGATTAAGGG - Intergenic
1075506225 10:123024886-123024908 ACTTGGCTTTAGAAGGTTAGAGG + Intronic
1076683802 10:132187758-132187780 TCTCTGCTCTCGAAGGTTCAGGG - Intronic
1079091727 11:17485448-17485470 TTTCAGATTTAGTAGGTTAGGGG - Intergenic
1081117482 11:39221839-39221861 TATCAGCTTTAGAACTCTAAAGG - Intergenic
1082144871 11:48654654-48654676 TATCAGCTTAAGAAGGTTTTGGG + Intergenic
1087308966 11:96518013-96518035 TATCAGCTTTAGAAGGTTTTGGG + Intergenic
1087853795 11:103065925-103065947 AATCAGATTTAGAAGCTTAAAGG + Intronic
1092569375 12:9706234-9706256 TCTCAGCTTAAGAAGCTTTTGGG + Intergenic
1097565433 12:61263507-61263529 TCTCAGCTTAAGAAGCTTTTGGG - Intergenic
1097614593 12:61868743-61868765 TCTTAGCTTGAGGAGGTTATAGG + Intronic
1099784686 12:87246580-87246602 TATAACCTTTAGAAAGTTAAGGG + Intergenic
1099944069 12:89224248-89224270 TGTCAGCTTAACAAGGCTAAAGG + Intergenic
1101200742 12:102433505-102433527 TTCCATATTTAGAAGGTTAATGG - Intronic
1101888055 12:108686416-108686438 TCTAAGCTTTAGAAGATTGGTGG - Intronic
1104828198 12:131729978-131730000 TCTCAGCTTTAAAAGGTTTTTGG - Intronic
1105215181 13:18280032-18280054 TCTCTGCTTGAAAAGTTTAATGG + Intergenic
1105747537 13:23391919-23391941 TGTCAGCTTCTGAAGGGTAAGGG - Intronic
1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG + Intronic
1106877963 13:34096091-34096113 TGTCAGCTTGAGTGGGTTAAGGG - Intergenic
1107218594 13:37952445-37952467 TATCAGCTTAAGAAGGTTTTGGG + Intergenic
1108046042 13:46386168-46386190 TGTGTGGTTTAGAAGGTTAATGG - Intronic
1108916859 13:55624468-55624490 TCTCAGCTTATGAAGATAAAAGG + Intergenic
1109244837 13:59941206-59941228 TCTCAGTTTTATATAGTTAAAGG - Intronic
1110535268 13:76643796-76643818 AGTCATCTTTAAAAGGTTAAAGG + Intergenic
1112218238 13:97458857-97458879 ACTTAGCTGTAGAATGTTAATGG - Intronic
1112757694 13:102656721-102656743 TCTCAGATTTAAAATGTGAAAGG + Intronic
1114971471 14:28034971-28034993 TATCAGCTTAAGAAGGTTCTGGG - Intergenic
1116101589 14:40444791-40444813 TCTCAGCTTGAGATGCTTAGTGG + Intergenic
1116323415 14:43498433-43498455 TATCAGCTTTAGAAGCTTTTGGG - Intergenic
1116765061 14:49060126-49060148 TCTAAGGATTAGAAGATTAAAGG - Intergenic
1117002044 14:51380560-51380582 TCTCAGGTTTAGTGGGCTAATGG + Intergenic
1117576337 14:57102363-57102385 TATCAGCTTAAGAAGATTATGGG + Intergenic
1119432836 14:74579473-74579495 TCTCAGCATCAGTAGGTTAAAGG + Intronic
1119887393 14:78154336-78154358 TCTCAGCTTTTGAATCTTAGTGG + Intergenic
1120638251 14:86978205-86978227 TCTCAGCTTAAGAAGCTTTTGGG - Intergenic
1121822596 14:96983584-96983606 TCTCAGCTTTTGAATGATGATGG + Intergenic
1122100432 14:99404903-99404925 TTTCACCTTGAAAAGGTTAATGG - Intronic
1124263433 15:28212690-28212712 TCTCAGCTATAAAAGGCTTACGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132026619 15:98409106-98409128 TCCCACATCTAGAAGGTTAATGG - Intergenic
1132755119 16:1480533-1480555 TCTCAGCTTTAGAGGCTCTAAGG - Intergenic
1133509674 16:6445380-6445402 TCTGAGCTTTAGATGCATAAAGG - Intronic
1138123378 16:54418805-54418827 TCTCAGCTTCAGAATCTTCAGGG + Intergenic
1140077738 16:71717850-71717872 TCTAAGATTTAGAAGGTCAGTGG - Intronic
1142650224 17:1344957-1344979 TGTTAGCTTGAGATGGTTAAAGG - Exonic
1143354955 17:6320526-6320548 TCTCTGCTTTAGAAGGTCAAAGG - Intergenic
1144784665 17:17824896-17824918 TCCCAGCTTTGGGAGGTTCAAGG + Intronic
1149270821 17:54975590-54975612 TTTAACCTTTAGAAGGTTAAAGG + Intronic
1150897716 17:69233777-69233799 TCTCAGCATTAGAGCATTAAAGG + Intronic
1150986349 17:70201937-70201959 TCTCAACCTAAGAATGTTAAGGG - Intergenic
1151482063 17:74375601-74375623 TCTCAGATGTAGAAGATTAGAGG + Intergenic
1153742890 18:8147524-8147546 TATCAGCTTAAGGAGGTTAGGGG + Intronic
1155949037 18:31887963-31887985 TATCAGCTTAAGAAGGTTTTGGG - Intronic
1157694718 18:49712358-49712380 TCTCAGCTTAAGGAGATTTAGGG + Intergenic
1161121963 19:2532574-2532596 TATCAGTTTTAGAAAGTTATTGG - Intronic
1163086392 19:14983376-14983398 TCTAAGCTCTAGAAGGTTGTGGG + Intronic
1163951447 19:20591516-20591538 GCTCAGCGTTAGAAGGTAACTGG + Intronic
1168300139 19:55400266-55400288 TCCCAACTTTAGGAGGTGAAAGG - Exonic
926378263 2:12257177-12257199 TCAAAGCTAAAGAAGGTTAAGGG + Intergenic
929242751 2:39668362-39668384 TCTCAGCTTTATAATATTGATGG + Intronic
929342294 2:40835837-40835859 ACTCTGCTTTAGAAGGTGGAGGG + Intergenic
930402804 2:50912126-50912148 CCTCAGCTTTTGGAGGTCAAAGG + Intronic
930886059 2:56328348-56328370 GCTCAGCTTTCTAAGGTTCAAGG + Intronic
930987262 2:57605439-57605461 TCTCAGCCTTTCAAGGTTACAGG + Intergenic
931820782 2:65949873-65949895 TCCCAGCTTTAGAAGGTTCTTGG - Intergenic
932395529 2:71444668-71444690 TCTCAGCTTACGAAGGTAACAGG - Intergenic
932840250 2:75075113-75075135 TCTCAGCTTTAATGGTTTAATGG - Intronic
933269744 2:80220811-80220833 TCTAAGCTTTAGGACCTTAAGGG + Intronic
934299139 2:91766705-91766727 TCTCTGCTTGAAAAGTTTAATGG - Intergenic
934973007 2:98778434-98778456 TCCCAATTTTAGAAGGTCAAGGG + Intergenic
935109993 2:100083778-100083800 CCTCAGCTTTACAAGGCTAAGGG + Intronic
936124987 2:109781430-109781452 CCTCAGCTTTACAAGGCTAAGGG - Intergenic
936219706 2:110590038-110590060 CCTCAGCTTTACAAGGCTAAGGG + Intergenic
937165996 2:119818039-119818061 TATCAGCTTAAGAAGCTTGAGGG + Intronic
937484826 2:122304450-122304472 TCTCAGATTTAGGAGCTTTAGGG - Intergenic
938247386 2:129789268-129789290 TATCAGCTTAAGAAGGTTTTGGG + Intergenic
939216845 2:139249581-139249603 TATCAGCTTAAGAAGCTTTAGGG + Intergenic
939365335 2:141223150-141223172 TATCAGCTTTAGAAGCTTTTGGG - Intronic
939434796 2:142161469-142161491 TATCAGCTTAAGAAGGTTTTGGG - Intergenic
941146659 2:161855405-161855427 TCTCACCATTAGAAAATTAAAGG + Intronic
941146732 2:161856835-161856857 ACTAAGATTTAAAAGGTTAAAGG + Intronic
941293789 2:163710238-163710260 TCTCAGTTTTAGAGAGTGAATGG - Intronic
941991032 2:171557210-171557232 TATCAGCTTTTGAAAGATAAAGG - Exonic
942511692 2:176709485-176709507 TCTCAGCTTCAGGAGGTTAGAGG + Intergenic
942860361 2:180602247-180602269 TCTCAGATTTTGAAAGATAAAGG - Intergenic
942919466 2:181353996-181354018 TCTCTGCTTTAAAATGTTACAGG + Intergenic
943260522 2:185654679-185654701 GGTCAGCTTTAGATGGTCAAAGG + Intergenic
944113208 2:196157983-196158005 ACTCAGCCTTATAAGGTTTATGG - Intronic
945533531 2:210985089-210985111 TCTCAGCTTAAGGAGGTTTTGGG + Intergenic
945535660 2:211014764-211014786 TCTGAGTTTTGGAAGGTTAAAGG - Intergenic
945920875 2:215753514-215753536 TCACAGCTTTTGAAAGTTATAGG + Intergenic
947930013 2:233956973-233956995 ACTCAGCTAAAGATGGTTAAGGG + Intronic
1168918260 20:1509557-1509579 TCTCAGCTTTTGCAACTTAAAGG - Intergenic
1170187559 20:13608025-13608047 TCTCAGCTTTAGAAGGTTAAAGG - Intronic
1170413619 20:16116794-16116816 TGTCAGCTTAAGAAGGTTTTGGG + Intergenic
1171110629 20:22478295-22478317 TATCAGCTTTAGAAGCTTTTGGG - Intergenic
1172738598 20:37147998-37148020 TCTCAACTCAAGAAGTTTAAGGG + Intronic
1174550185 20:51356476-51356498 TCTCAGCCTTAGAAGGGAAGGGG + Intergenic
1174580497 20:51568117-51568139 TCTCAGCTTTAGACTCTAAAGGG + Intergenic
1174907162 20:54563412-54563434 CCTCCCCTTTAGAAAGTTAATGG + Intronic
1177308278 21:19350166-19350188 TCTCAGCTTTAGAATTTCAGAGG - Intergenic
1182533190 22:30978381-30978403 TCTCTGCTTAAGAAGTTGAATGG - Intergenic
1183503089 22:38192934-38192956 TCTGAGCTTTAGAAGGCAAGGGG + Intronic
949155568 3:822891-822913 ACACAGCTTTAGAAAGTTAAAGG - Intergenic
949373457 3:3361109-3361131 TCTCAAATTTAGAAGCTAAAAGG - Intergenic
949878108 3:8640113-8640135 TTTCAGATTTACAAGGTGAAAGG + Intronic
950094245 3:10319530-10319552 ACTCAGCATTAGAAGGTTAGGGG - Intronic
954769877 3:52957086-52957108 TCTCAGCTTAAGAAGCTTTTGGG - Intronic
956669547 3:71673518-71673540 ACTCAGCTTTAGAAATCTAAGGG + Intergenic
959537239 3:107500282-107500304 TCAAAGATTTAGGAGGTTAATGG - Intergenic
960214703 3:115017145-115017167 TATCAGCTTAAGAAGGTTTTGGG - Intronic
960514701 3:118590538-118590560 TCTAAGATTTAGGGGGTTAAAGG + Intergenic
960679719 3:120234902-120234924 TATCAGCTTAAGAAGGTTTTGGG + Intronic
962122061 3:132572177-132572199 TATCAGCTTAAGAAGCTTTAGGG - Intronic
963335443 3:143970053-143970075 TCTCAGCTTAATCAGTTTAATGG + Intergenic
964890238 3:161526019-161526041 TATCAGCTTAAGAAGGTTTGGGG + Intergenic
965845634 3:172958247-172958269 TGCCAGCTTTGGAAGGCTAATGG + Intronic
967560945 3:190919437-190919459 TCTTTGCTTTATAATGTTAATGG + Intergenic
968262682 3:197337815-197337837 ACTCAGCTTAAGAAGGTAATGGG + Intergenic
968982337 4:3857035-3857057 TCTCAGCTGGAGAGGGTCAAAGG - Intergenic
969634580 4:8359434-8359456 TCTCAGATTTAGGGGGTTAGAGG + Intergenic
969852929 4:9976378-9976400 TCTCAGTCTTTGAAGGTAAATGG + Intronic
970069736 4:12144132-12144154 TCTCAGCTTTTGAAGGCAGAGGG - Intergenic
970306387 4:14736600-14736622 TATCAGCTTTAGAAGCTTTTGGG - Intergenic
970998002 4:22290169-22290191 TATCAGCTTTAGAAGATTTTGGG + Intergenic
971214812 4:24653014-24653036 TCTCAGAATGAGAAGGGTAAAGG + Intergenic
971429439 4:26549353-26549375 TCTCAGCTAGAGGAGGTTACAGG + Intergenic
972892908 4:43581840-43581862 TATCAGCTTAAGAAGGTTTTGGG + Intergenic
973315867 4:48759555-48759577 TCTTGGCTTTAGAAGTTTAGAGG + Intronic
974177901 4:58347525-58347547 TCTCAGCCTTAGATGGATAGAGG - Intergenic
975323532 4:73035371-73035393 TCTCAGCTTCAGAAAGTGATGGG - Intergenic
976311532 4:83618026-83618048 TCACAGCTTTAGAGGGCAAACGG - Intergenic
977520031 4:98070626-98070648 TATCAGCTTAAGAAGGTTTTGGG - Intronic
977999942 4:103546020-103546042 TCACACCTTTAGAAGGTTAGAGG - Intergenic
978978941 4:114917840-114917862 TCTCAACTTTACATGGTTGATGG + Intronic
979160373 4:117452326-117452348 TCTCAGCTTAAGAAGCTTTTAGG - Intergenic
979170701 4:117598372-117598394 GCTCAGCTTTAATAGGTTCAGGG + Intergenic
980342095 4:131563895-131563917 TCTAAGCTTTAGAACGTTGTAGG - Intergenic
981024390 4:140062217-140062239 TCTCTGCTTAAGAAGGCAAAAGG - Intronic
981624702 4:146742425-146742447 TCTCAGCTCTAGAAGATGCAGGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984894391 4:184524328-184524350 TATCAGCTTAAGAAGGTTTTGGG + Intergenic
984971194 4:185192701-185192723 TCTGATCTTAAGAAGGTCAAAGG - Intronic
985115863 4:186589861-186589883 TCTAAACTTTAGCATGTTAAAGG - Intronic
985983983 5:3498055-3498077 TCTCAGCTTAAGAAGCTTTTGGG - Intergenic
986209729 5:5659632-5659654 TCTCAGCATTAACAGGTTAAAGG - Intergenic
986416269 5:7531071-7531093 TCTGAGCTCCTGAAGGTTAATGG + Intronic
987946843 5:24620896-24620918 TTTCAACTTTTGAAGGTTTATGG + Intronic
988659139 5:33245774-33245796 TTTCAGCTATAGAAGGTGAAAGG + Intergenic
989069066 5:37491076-37491098 TCTCAGCTTGTCAGGGTTAAGGG + Intronic
989158420 5:38367026-38367048 GCTCAGCTTTGGAAGGTTGCTGG - Intronic
990085166 5:51967726-51967748 TGTAAGCTTTAAATGGTTAAGGG + Intergenic
993336103 5:86660908-86660930 TATCAGCTTAAGAAGGTTTTGGG + Intergenic
993693349 5:91030167-91030189 TCTCATCATTAGCAGATTAAAGG - Intronic
994762487 5:103873671-103873693 TCTCAGCTATTAAAGTTTAAAGG - Intergenic
995012761 5:107276305-107276327 TCTCAGGGTTAGAAGAGTAATGG + Intergenic
995738261 5:115327059-115327081 TCTCTGCTTTAGAAGTAAAAGGG + Intergenic
995800313 5:115986578-115986600 GCTCAGCTTTACAAAGTTAATGG + Intronic
998888007 5:146714897-146714919 TCTCAGCTTCAAAAGGAGAAGGG - Intronic
999932167 5:156445452-156445474 TATCAGCTTTAGAAAGGGAAGGG + Intronic
999958818 5:156732021-156732043 TCTCAGCTTAAGAAGCTTTTGGG + Intronic
1000076611 5:157794204-157794226 TCCCAGTTTTAGAAAGTTGAAGG + Intronic
1002911727 6:1495966-1495988 ACTCAGCTTTAAAAGGTGCAGGG - Intergenic
1008083069 6:47214300-47214322 TATCAGCTTAAGAAGGTTTTGGG - Intergenic
1009476046 6:64093632-64093654 TATCAGCTTTAGAAGATTTTGGG + Intronic
1010866373 6:80980927-80980949 TCTCATCTCTAGAATGCTAATGG + Intergenic
1011012603 6:82718966-82718988 TATCAGCTTTAGGAGGTTTTGGG - Intergenic
1011566721 6:88681929-88681951 TCACAGCTTTAGAAGTTAATAGG + Intronic
1011805373 6:91066653-91066675 TCTCTGCTTTAGCAGATTAAAGG - Intergenic
1011916689 6:92514593-92514615 TATCAGCTTAAGAAGGTTTTGGG - Intergenic
1012139763 6:95611097-95611119 TTTCAGTTTTACAAGATTAAGGG - Intergenic
1012224358 6:96687865-96687887 TCTCAGCAATATAAAGTTAAAGG - Intergenic
1015427586 6:133089996-133090018 TCTCAGCTTTTTAATATTAAGGG - Intergenic
1015797344 6:137026187-137026209 CTTCAGCTTTAGAAGGCTAAAGG - Intronic
1016130361 6:140460829-140460851 CCTCTGCTTTTCAAGGTTAACGG + Intergenic
1017390739 6:153936603-153936625 TATCAGCTTAAGAAGGTTTTGGG + Intergenic
1017426420 6:154326332-154326354 TATCAGCTTAAGAAGGTTTTGGG - Intronic
1018062074 6:160097954-160097976 TTTCAGCTTTTGAATGTTTATGG + Intronic
1018975118 6:168558563-168558585 TCTCATCTTTAAAATGGTAATGG + Intronic
1019089401 6:169515143-169515165 TTTCAGCTTTAGTAAATTAAGGG - Intronic
1021307550 7:19050006-19050028 TATCAGCTTAAGAAGATTTAGGG - Intronic
1021467095 7:20956461-20956483 TCACAGTTCTAGAAGGTTTAAGG + Intergenic
1022107681 7:27208631-27208653 TCTCAGGTTGAGAGGATTAAGGG + Intergenic
1022601360 7:31763172-31763194 ACTTAGCTTTAGAAGGATAATGG + Intronic
1022889474 7:34681800-34681822 TCTCAGCTTTGAAAGATTTAGGG - Intronic
1023299017 7:38748757-38748779 TTTCAGGTTTAAAAAGTTAATGG - Intronic
1023585196 7:41722551-41722573 ACTAAGATTTAGAGGGTTAAGGG - Intergenic
1024146915 7:46526293-46526315 TGCCTGGTTTAGAAGGTTAAAGG + Intergenic
1024372533 7:48603107-48603129 TCTCAGCTTTAGGAGATTTAGGG + Intronic
1027946669 7:84755615-84755637 TCTTAGATTTAATAGGTTAAAGG - Intergenic
1028154137 7:87410305-87410327 TCTTAGCTTTAGAAATTTGAAGG - Intronic
1028853927 7:95568464-95568486 TCTCAGCTTAAGGAGGTTTTGGG - Intergenic
1030177443 7:106669524-106669546 TATCAGGTTTAGTAGGTTAGGGG - Intergenic
1031668493 7:124514985-124515007 TTTCTGCTTTTGAGGGTTAATGG + Intergenic
1031943065 7:127809668-127809690 TCACAGCTTAAGAAAGATAATGG + Intronic
1035277458 7:157756574-157756596 GCTGAGCTTTAGAAGGTTAAAGG - Intronic
1040365479 8:46710767-46710789 TCCCAGCTTTAGAAGATTGAGGG - Intergenic
1041473602 8:58238310-58238332 TAGCAGCTTTGGAAAGTTAATGG + Intergenic
1041482354 8:58335834-58335856 TATCAGCTTTAGAAGCTTTTGGG - Intergenic
1041624127 8:60005717-60005739 TATCAGCTTAAGAAGCTTTAGGG - Intergenic
1042070420 8:64927326-64927348 TATCAGCTTTAGAAGATTTTGGG + Intergenic
1043014101 8:74916705-74916727 TTTCTGCTTTAGAAAGTTAGTGG + Intergenic
1049831981 8:144706515-144706537 TCTCCACATTAGAAAGTTAAGGG + Intergenic
1051009407 9:12392972-12392994 TCTCATGTTGAGAAGGCTAATGG + Intergenic
1053140962 9:35682421-35682443 CCTCTTCTTTAGAAGGTTTAAGG + Intronic
1055563494 9:77545357-77545379 TCTTAGCTTTCCAAGGTGAACGG - Intronic
1056001774 9:82225383-82225405 TCTTACCATAAGAAGGTTAAGGG - Intergenic
1057514264 9:95708182-95708204 TCTCAGCTTTAGGAGGCCAGCGG - Intergenic
1058858823 9:109094248-109094270 TGTCTGCTATAGAAGGTTAAAGG - Intronic
1060681395 9:125568178-125568200 TCTAAGATTTAGGGGGTTAAAGG + Intronic
1186468708 X:9804615-9804637 TCTCTGCTTCAGAAGGTCAGAGG + Intronic
1189506501 X:41616373-41616395 ACTGAGCTTCAGAAGGTTCATGG + Intronic
1189996962 X:46648087-46648109 TCTCAGCTTTACAGGGAAAAGGG + Intronic
1190137851 X:47813609-47813631 CCTAAGATTTAGAGGGTTAAAGG - Intergenic
1190189246 X:48262648-48262670 GCTCTGGTTTAGAAGGTAAAGGG + Intronic
1190658006 X:52629130-52629152 GCTCTGGTTTAGAAGGTAAAGGG + Intergenic
1190920984 X:54852240-54852262 TCTAAGATTTAGGAGGTTAGAGG - Intergenic
1191096432 X:56677969-56677991 TATCAGCTTTAGAAGATTTTGGG - Intergenic
1191813908 X:65222456-65222478 TATCAGCTTTAGAAGCTTTTTGG - Intergenic
1191831978 X:65425344-65425366 TCTCAGCTTAAGAAGCTTTTGGG + Intronic
1191958117 X:66668467-66668489 GCTCAGCTGTAGAAAGATAAAGG + Intergenic
1193073201 X:77328549-77328571 TATCAGCTTAAGAAGGTTTTGGG + Intergenic
1194984227 X:100472728-100472750 TATCAGCTTAAGAAGTTTTAGGG - Intergenic
1197557076 X:127968769-127968791 TCTCAGCTTACGAAGGTAACAGG + Intergenic
1198074770 X:133183848-133183870 TCTCTACTTTTGGAGGTTAATGG + Intergenic
1199491076 X:148401382-148401404 GATCTGCTTCAGAAGGTTAAAGG + Intergenic
1201756866 Y:17495718-17495740 TATCAGCTTAAGAAGGTTTGGGG - Intergenic
1201844687 Y:18410266-18410288 TATCAGCTTAAGAAGGTTTGGGG + Intergenic
1201928804 Y:19318928-19318950 TCTCAGCTTTTGAAAGTGGAGGG - Intergenic