ID: 1170187605

View in Genome Browser
Species Human (GRCh38)
Location 20:13608721-13608743
Sequence ACCAGGCATCTGGCCAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 2, 2: 10, 3: 67, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170187600_1170187605 23 Left 1170187600 20:13608675-13608697 CCATTTAAAAAAGTGAAAATCAT 0: 1
1: 3
2: 41
3: 276
4: 1480
Right 1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG 0: 1
1: 2
2: 10
3: 67
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170187605 Original CRISPR ACCAGGCATCTGGCCAGATT TGG Intronic
900568677 1:3347765-3347787 AGCAGGCATCAGGCCAGATCTGG - Intronic
900919554 1:5661927-5661949 ACCGGGCGTCTGGCCAGAGCTGG + Intergenic
901803497 1:11723203-11723225 ACCAGGCAGTGGGGCAGATTTGG + Exonic
902190687 1:14760995-14761017 GACAGGCAGCGGGCCAGATTTGG + Intronic
902559134 1:17266147-17266169 AACAGGCAGTAGGCCAGATTTGG + Intronic
902750074 1:18502058-18502080 AGCAGGCAGAGGGCCAGATTTGG + Intergenic
903727643 1:25462888-25462910 AACAGGCAGTGGGCCAGATTTGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
905786518 1:40762305-40762327 AGCAGCCATCTGGCCAGTGTGGG + Intronic
906099293 1:43247833-43247855 ACCAGTCATTTGGCCAGGTGCGG + Intronic
906937536 1:50227106-50227128 CTCAGGCTTCTGGCTAGATTTGG + Intergenic
907967899 1:59350976-59350998 AACAGGCAGTAGGCCAGATTTGG - Intronic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
908741640 1:67334841-67334863 AACAGGCAGAGGGCCAGATTTGG + Intronic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
911456895 1:98136306-98136328 ATCAAGCATTGGGCCAGATTTGG - Intergenic
914736368 1:150421071-150421093 AATAGGCAGCAGGCCAGATTTGG + Intronic
915406557 1:155664433-155664455 ACCAGGAAACTGGCCAGACATGG + Intronic
915565263 1:156709394-156709416 ACCAAGGATCAGGCCAGACTGGG - Intergenic
916083002 1:161247901-161247923 CACAGGCAGCAGGCCAGATTGGG - Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
918198705 1:182246953-182246975 AACAGGCAGTGGGCCAGATTTGG + Intergenic
918798812 1:188943741-188943763 ACCAGTCATCTGGTTAAATTAGG + Intergenic
920272238 1:204774577-204774599 ACCAGTCACCTAGCCAGATATGG + Intergenic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
922761516 1:228134928-228134950 ACCAAGCTTCTGGGCAGAATGGG - Intergenic
922907207 1:229183233-229183255 ACCAGGGATCTGGTAAGATCAGG + Intergenic
923562528 1:235052110-235052132 AACAGGCCACTGGCCAGATTTGG + Intergenic
923603570 1:235423855-235423877 TCCAGGCAGCTGGCAGGATTCGG + Intronic
924662872 1:246038055-246038077 AACAGGCAGCAGGCCAGATATGG + Intronic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1064199471 10:13272391-13272413 AACAGGCATCCCGCCAGATGTGG - Intergenic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1064532788 10:16327170-16327192 ACCAGGTAGTGGGCCAGATTTGG - Intergenic
1068581675 10:58747834-58747856 CACAGGCAGCTGGCCAGATTTGG - Intronic
1068633436 10:59322062-59322084 AGCAGGCGTCTGGCCAGGTTTGG - Intronic
1069571279 10:69495800-69495822 AGCAGGTGGCTGGCCAGATTGGG + Intronic
1070237175 10:74640765-74640787 AATAGGCAGCTAGCCAGATTTGG + Intronic
1070326689 10:75394397-75394419 ACCAGGCTGCTAGCCACATTCGG + Intergenic
1070379576 10:75868696-75868718 ACCAAGCATCTGGACACACTGGG - Intronic
1070431971 10:76349351-76349373 AACAGGCAGTGGGCCAGATTTGG + Intronic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072865733 10:99059147-99059169 AACAGGAAGCAGGCCAGATTTGG + Intronic
1074538456 10:114345607-114345629 ATCAGGGATGTGGCCAAATTGGG - Intronic
1074876150 10:117614839-117614861 AACAGGCAGCTGGAAAGATTTGG - Intergenic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1077340474 11:2024176-2024198 ACCATCCAGCTGGCCAGATGAGG - Intergenic
1077523366 11:3049488-3049510 GCCAGGCTTCTGGCCAGAGGAGG + Intronic
1077658698 11:4046941-4046963 AACAGGCATTTGGCCAGACATGG - Intronic
1078996368 11:16704965-16704987 ACTAGGCATCAGGCCAGGTGTGG + Intronic
1082196671 11:49315086-49315108 AAAAGGCATCTGGCTACATTTGG - Intergenic
1083189289 11:61037823-61037845 ACCAGGCATCGGGCCAGCTCTGG + Intergenic
1083810315 11:65101278-65101300 ACCAGGCATTGAGCCAGATTTGG + Intronic
1083865585 11:65451460-65451482 ACGGGGCAGCTGGCCAGGTTGGG - Intergenic
1084313127 11:68328118-68328140 GCCAGGGAACTGGACAGATTTGG - Intronic
1084682526 11:70674844-70674866 AACAGGCAATGGGCCAGATTTGG + Intronic
1085607437 11:77914747-77914769 AGCAGGCAACAGGCCAGCTTTGG + Intronic
1086384302 11:86291340-86291362 AACAGACAGCTGGCCAGGTTCGG - Intergenic
1086659155 11:89393119-89393141 AAAAGGCATCTGGCTACATTTGG + Intronic
1086888514 11:92228768-92228790 ACCAGGCAACTGGACAGATGTGG - Intergenic
1086971781 11:93089348-93089370 ACCAGGCACTCGGCAAGATTTGG - Intergenic
1087357291 11:97110719-97110741 AACAGGCATCTGACTGGATTTGG - Intergenic
1088726544 11:112642173-112642195 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1089169836 11:116504338-116504360 ACCTGACATCTGGCCACTTTGGG - Intergenic
1090694085 11:129219070-129219092 ACCAGCCATTGGGCCACATTGGG + Intronic
1202823459 11_KI270721v1_random:79365-79387 ACCATCCAGCTGGCCAGATGAGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1091899474 12:4133486-4133508 ACCAAGCATCTGGCAAGTGTTGG - Intergenic
1092846155 12:12587004-12587026 AACAGGCAATTGGCCAGCTTAGG + Intergenic
1093094933 12:14961185-14961207 AGCAGGCACCTGGCCAGGCTTGG - Intronic
1093685587 12:22050030-22050052 TCCAGGCATCTGGAGAGATTAGG + Intronic
1093967050 12:25339280-25339302 ACCAGCCAACTGGCCGGATGTGG + Intergenic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1094554566 12:31485600-31485622 AACAGTCAGCTGGACAGATTTGG + Intronic
1095425785 12:42073335-42073357 ACCACGCACCTGGCCAGGTATGG - Intergenic
1095454543 12:42369010-42369032 AACAGACAGCTGACCAGATTTGG - Intronic
1095549900 12:43423303-43423325 AATAGGCAACAGGCCAGATTTGG + Intronic
1096076936 12:48811808-48811830 ATCAGGCCTCTGGACAGACTGGG - Intergenic
1096371865 12:51075670-51075692 AACAGGCATTGGGCCAGATTTGG + Intronic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1098377346 12:69831216-69831238 AACAGGCTGCAGGCCAGATTTGG - Intronic
1098848399 12:75566012-75566034 ACCAGGCACTGGGCCAGGTTTGG + Intergenic
1100392706 12:94158015-94158037 AACAGGCAACAAGCCAGATTTGG + Intronic
1101208013 12:102508208-102508230 AACAGGCAATGGGCCAGATTTGG - Intergenic
1101814541 12:108135797-108135819 AACAGGCAGTGGGCCAGATTTGG - Intronic
1102033104 12:109754620-109754642 AGCAGCCAGCAGGCCAGATTTGG + Intronic
1102178605 12:110894666-110894688 CCCAGGCATCTGCCCAGCTTGGG - Intronic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103098865 12:118154963-118154985 ACCAGGCACCAGGCTAGATTTGG - Intronic
1103403975 12:120661792-120661814 AATAGGCATCTGGACAGATAAGG - Intronic
1103849544 12:123923196-123923218 AGCAGGCAGTGGGCCAGATTTGG - Intronic
1103964137 12:124627351-124627373 ACCAGGCAACAGGCCAGATCTGG - Intergenic
1104910865 12:132240367-132240389 ACCAGCCACCTGGCCAGCATGGG - Intronic
1105661616 13:22502119-22502141 TACAGGCATCAGGCCAGATTTGG + Intergenic
1107896105 13:44965416-44965438 ACCAGGCATGGGGCCAGGTGCGG + Intronic
1108293199 13:48983557-48983579 ACTAGGCAGCAGACCAGATTTGG + Intronic
1110403420 13:75120956-75120978 AACAGGCAGGGGGCCAGATTTGG + Intergenic
1110605747 13:77430117-77430139 AATAGGCATCCGACCAGATTTGG - Intergenic
1114707386 14:24741151-24741173 ACCAGCCATATGGCAAGATATGG + Intergenic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1118246222 14:64113610-64113632 ACCAATCATCTGCCAAGATTGGG + Intronic
1118773442 14:68957739-68957761 GCAAGGCATCTGGCCAGCATGGG + Intronic
1119067716 14:71547006-71547028 ACTACGCTTCTGGCTAGATTTGG - Intronic
1120220702 14:81729742-81729764 TCCAGGCCACTGGCCAGCTTTGG - Intergenic
1121315956 14:92961161-92961183 AACAGGCATCTGACCGGAGTGGG - Intronic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1121615897 14:95313458-95313480 AAGAGGCAGCAGGCCAGATTTGG + Intronic
1122256580 14:100482567-100482589 ACCATGGATCTAGGCAGATTGGG + Intronic
1122960050 14:105090138-105090160 TCCAGGCATCAGGCCAGGTCTGG - Intergenic
1124603550 15:31153612-31153634 ACCTGGAATCTGGCCAGACACGG - Intronic
1124715865 15:32061127-32061149 ACCATGAATCTGGCCAGCATTGG - Intronic
1125826357 15:42679801-42679823 AACAGGCAGCAGACCAGATTTGG + Intronic
1126614499 15:50563122-50563144 AACAGGCAACAGACCAGATTTGG - Intronic
1126651926 15:50931807-50931829 ACCAGGCATTTGGCCAGATTAGG + Intronic
1126932537 15:53670905-53670927 ACTGGGCATATGGCCAGCTTGGG + Intronic
1126934793 15:53694902-53694924 AACAGGCAGCAGGCCTGATTTGG - Intronic
1128105337 15:65040262-65040284 ACCAGGCTGCAGGTCAGATTTGG + Intergenic
1128190705 15:65692926-65692948 AACAGGCCTCAGGCTAGATTTGG - Intronic
1128973519 15:72130481-72130503 AGCAGGCAGTGGGCCAGATTTGG + Intronic
1129434584 15:75528221-75528243 AGCAGGCATCTTGCCAGCCTGGG - Intronic
1129557514 15:76528174-76528196 AACAGGCAGTGGGCCAGATTTGG + Intronic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1132107821 15:99076761-99076783 ACCAGGAATTGTGCCAGATTCGG - Intergenic
1133142998 16:3761928-3761950 AGCAAGCAGCTGGCCACATTTGG - Intronic
1133418138 16:5622614-5622636 CACAGGCATCGGGCCGGATTTGG - Intergenic
1134210592 16:12273197-12273219 AGCAGGCTTCTGGCTAGAGTAGG - Intronic
1134303923 16:13015140-13015162 AACAGGCGGCAGGCCAGATTTGG - Intronic
1134518524 16:14906340-14906362 AACAGACAGCTGGCCAGAGTTGG - Intronic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1134694574 16:16214008-16214030 AACAGGCAGTGGGCCAGATTTGG - Intronic
1134706195 16:16304993-16305015 AACAGACAGCTGGCCAGAGTTGG - Intergenic
1134961345 16:18407117-18407139 AACAGACAGCTGGCCAGAGTTGG + Intergenic
1134965645 16:18489720-18489742 AACAGACAGCTGGCCAGAGTTGG + Intronic
1134977261 16:18580629-18580651 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1135830900 16:25772104-25772126 ACAAGGCAGCAGGCTAGATTTGG + Intronic
1137783979 16:51122385-51122407 ACCAGGAAACTGGGAAGATTTGG + Intergenic
1139780463 16:69347275-69347297 AACAGGCAATGGGCCAGATTTGG + Intronic
1140761549 16:78113475-78113497 AACAGGCAGTGGGCCAGATTTGG + Intronic
1140814536 16:78608870-78608892 ACCATTCATGTGCCCAGATTTGG - Intronic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1141063103 16:80893077-80893099 ACCAGGCAGCAGGCTGGATTTGG + Intergenic
1141713808 16:85715680-85715702 AGCAGGCATCAGGCAGGATTGGG + Intronic
1141723416 16:85769734-85769756 ACAAGGCTTCTTTCCAGATTAGG - Intergenic
1141885162 16:86886693-86886715 AACAGGCAGCAGGCAAGATTTGG - Intergenic
1143823039 17:9580146-9580168 AACAGGCAGTGGGCCAGATTTGG - Intronic
1144294601 17:13861639-13861661 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1144621918 17:16823460-16823482 ACCAGGCTTCTTGCCATACTCGG - Intergenic
1144853321 17:18254899-18254921 ACCAGGCGTCTGCCAAGCTTGGG + Intronic
1144884505 17:18449254-18449276 ACCAGGCTTCTTGCCATACTCGG + Intergenic
1145147724 17:20495123-20495145 ACCAGGCTTCTTGCCATACTCGG - Intergenic
1146113531 17:30113389-30113411 ACCAGGCAGCTGGCCAGATTTGG - Intergenic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1146631160 17:34470435-34470457 AGCAGGCATCTGGTCAGATTTGG + Intergenic
1147727481 17:42575280-42575302 AACATGCATCTGGCAGGATTTGG - Intronic
1148692601 17:49539905-49539927 ACCAGGAATCTGGCCAGGTGAGG - Intergenic
1148978798 17:51553114-51553136 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1148983072 17:51596038-51596060 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1152507561 17:80760624-80760646 AACAGGCAGTTGGCCAGATTTGG + Intronic
1156086496 18:33411424-33411446 AAAAGGCTGCTGGCCAGATTTGG + Intronic
1157018631 18:43751084-43751106 AACAAGCAACAGGCCAGATTTGG + Intergenic
1157268902 18:46254470-46254492 AACAGGCAGCAGGCCAGAATTGG - Intronic
1157534088 18:48445829-48445851 AACAGGCAACGGACCAGATTTGG + Intergenic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157938348 18:51897867-51897889 AACAGGCAACTGGCCCGATTTGG + Intergenic
1158947847 18:62463457-62463479 AACAGGCAGCTGGCCTGATTTGG + Intergenic
1159049856 18:63410167-63410189 AACAGGCAGCTGGGCAGCTTTGG + Intronic
1160098611 18:75899851-75899873 ACCAGGCAGTAGGCCAGATTTGG - Intergenic
1161743992 19:6043522-6043544 AACAGGCAGTGGGCCAGATTTGG - Intronic
1162084200 19:8238596-8238618 AGCAGGCACCAGGCCAGAGTTGG + Intronic
1162427063 19:10603046-10603068 TCCAGGCGGCTGGCCAGACTCGG - Intronic
1163409172 19:17142835-17142857 AACAAGCATCAGACCAGATTTGG + Intronic
1163644316 19:18479820-18479842 TCCTGGGACCTGGCCAGATTGGG - Intronic
1164850701 19:31481019-31481041 AATAGGCAGCGGGCCAGATTTGG + Intergenic
1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG + Intergenic
1166540356 19:43601138-43601160 ACCAGGCAGCAGGCTAGAGTTGG - Exonic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1168366247 19:55790405-55790427 ACCAGGCAGAGGGCCAGATTTGG + Intronic
1168411835 19:56145095-56145117 AACAGGCTGCAGGCCAGATTCGG + Intronic
925473126 2:4184186-4184208 ACCAGGCAGCTGGCCAGGTGTGG - Intergenic
928140881 2:28727932-28727954 AACAGGCTCCTGGCCACATTTGG - Intergenic
928243475 2:29606628-29606650 AACAGGCAATGGGCCAGATTAGG - Intronic
928465345 2:31518125-31518147 TGCAGGCTTCTGTCCAGATTGGG + Intergenic
929196433 2:39189605-39189627 AACAGGCAGTAGGCCAGATTTGG - Intronic
929209879 2:39344290-39344312 ATCAGGCAGCAGGCTAGATTTGG - Intronic
929987992 2:46756467-46756489 AACAGGCCACAGGCCAGATTTGG + Intronic
930921053 2:56754433-56754455 CCCAGGCATCCTGCCAGTTTGGG - Intergenic
931119926 2:59205086-59205108 AACAGGCATCAGGTCTGATTTGG + Intergenic
931800134 2:65750096-65750118 ACCAGGCGGTGGGCCAGATTTGG + Intergenic
932276080 2:70453346-70453368 ACCAGGCTCCTGCCCAGACTGGG - Intronic
932417416 2:71581824-71581846 AGCAGGCAGAGGGCCAGATTTGG - Intronic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933979036 2:87535719-87535741 AACAGGCAGAGGGCCAGATTTGG + Intergenic
935062148 2:99617985-99618007 ACCAGGCTTCTGGTCCCATTTGG + Intronic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
936314791 2:111415073-111415095 AACAGGCAGAGGGCCAGATTTGG - Intergenic
936959205 2:118055969-118055991 TCCAGGCAGCTGGCCTGATGAGG - Intergenic
937139716 2:119589363-119589385 GCCAGGCATCTGGCTTGACTTGG + Intronic
937177303 2:119952715-119952737 ACAAGTCAGCTGTCCAGATTGGG - Intronic
937690360 2:124748708-124748730 ACCAGGCATCTGTCTTCATTGGG + Intronic
938170962 2:129076305-129076327 GCTAGGCATCTGGCCAGGTAAGG + Intergenic
938405170 2:131028451-131028473 ACCAGCCATCTGGGCAGGCTGGG + Intronic
938748261 2:134302196-134302218 AACAGGCAGTGGGCCAGATTTGG + Intronic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
940793507 2:158052932-158052954 AACAGGCATTGGGTCAGATTTGG + Intronic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
943726555 2:191257299-191257321 ACCAGGAATCTTGGAAGATTGGG + Intronic
944487580 2:200223006-200223028 AACAGGCAGCGGGCCAGGTTTGG + Intergenic
945712196 2:213312022-213312044 ATCAGGAAGCAGGCCAGATTTGG - Intronic
946842100 2:223829289-223829311 AACAGGCAGAAGGCCAGATTTGG - Intronic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
947898127 2:233694277-233694299 AACAGGCCTTTGGGCAGATTGGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
948931633 2:241135948-241135970 TCCAGGCAGCTGGCCAGGTCTGG + Exonic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169809030 20:9590387-9590409 AACAGGCAGAGGGCCAGATTTGG - Intronic
1169837910 20:9900941-9900963 AAGAGGCAGCAGGCCAGATTTGG - Intergenic
1169893612 20:10479048-10479070 CTCAGGCCTCTGCCCAGATTCGG + Intronic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170536734 20:17348291-17348313 TCCAGGCATCTGGGCAGCTTTGG + Intronic
1170853345 20:20023982-20024004 AACAGGCAGTGGGCCAGATTTGG - Intronic
1173150674 20:40564159-40564181 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1173325367 20:42027979-42028001 ATCAGGCAGAGGGCCAGATTTGG + Intergenic
1173451107 20:43164891-43164913 AACAGGCAGCAGGCCAGATCTGG + Intronic
1173625337 20:44468192-44468214 ACCAGGCTACTGGCCAGGTGCGG + Intergenic
1173971993 20:47160400-47160422 AACAGGCGACAGGCCAGATTTGG + Intronic
1174190053 20:48734217-48734239 AACAGGCAGAGGGCCAGATTAGG - Intronic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175451002 20:59068019-59068041 AACAGAGAGCTGGCCAGATTTGG - Intergenic
1175581459 20:60102987-60103009 ATCAGGCAGTGGGCCAGATTTGG - Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1176262943 20:64192579-64192601 ACCAGGCATGTGGACAGCTCAGG + Intronic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177607986 21:23407156-23407178 AACAGGCAGCAAGCCAGATTTGG + Intergenic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1178604023 21:34019535-34019557 AACAGGCAATGGGCCAGATTTGG - Intergenic
1178692177 21:34759230-34759252 ACCCAGCAGCCGGCCAGATTGGG - Intergenic
1179182051 21:39053889-39053911 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1179411140 21:41164260-41164282 AACAGGCAGTTGGCCAGATTTGG + Intergenic
1179415490 21:41195081-41195103 AACAGGTAGCTGGCCAGATTTGG - Intronic
1179420739 21:41234386-41234408 AACAGGCAGCAGGTCAGATTTGG - Intronic
1181808427 22:25389398-25389420 GCCAGGGAACTGGACAGATTTGG + Intronic
1182010018 22:26992851-26992873 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182429310 22:30290707-30290729 AGCAGGCCTCAGGCCTGATTGGG + Intronic
1182891422 22:33822095-33822117 ACCAGGCATCAGGCCAAGGTTGG - Intronic
1183026740 22:35070996-35071018 AACAGGGGTCAGGCCAGATTTGG + Intronic
1184342238 22:43892220-43892242 ACCAGAGATCAGGCAAGATTTGG - Intergenic
1185325785 22:50225267-50225289 ACCAGGCACCAGGCCAGAAAGGG + Intronic
949345593 3:3073379-3073401 AACAGGCAACAAGCCAGATTTGG - Intronic
950159380 3:10748249-10748271 AACAGGCAGTGGGCCAGATTTGG + Intergenic
950964019 3:17133707-17133729 ACCAGGCAACGGGCCGGATCTGG - Intergenic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
951883378 3:27501155-27501177 AACAGGCAGCTGGTCAGTTTTGG - Intergenic
954461243 3:50628185-50628207 GCCAGGCCTCTGGCCAGCTCTGG - Intronic
954970540 3:54648178-54648200 AGCAGGCAATGGGCCAGATTTGG - Intronic
955139892 3:56258698-56258720 ACCAGGGAGCTGGCTGGATTTGG + Intronic
955144733 3:56305767-56305789 AGCAGGCAAAAGGCCAGATTTGG - Intronic
955591723 3:60543233-60543255 AACAGGCAGCAGCCCAGATTTGG + Intronic
955666991 3:61360307-61360329 ACCAGACAGCTGGCCAGATTTGG + Intergenic
955794249 3:62619011-62619033 ACCAGGCAATAGGCCAGAATTGG - Intronic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
956865499 3:73364992-73365014 AACAGGCATCAGGCTGGATTTGG - Intergenic
957023472 3:75151596-75151618 CTCAGGCATCTAGCCAAATTTGG + Intergenic
957110326 3:75947377-75947399 AACAGGCAGCAGGCCAGATCTGG - Intronic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
960765577 3:121126211-121126233 AACAGGCAGCATGCCAGATTTGG - Intronic
961472328 3:127123710-127123732 AATAGGCAACAGGCCAGATTTGG + Intergenic
961776016 3:129286117-129286139 AACAGGCAGTAGGCCAGATTTGG - Intronic
962502169 3:136006584-136006606 AACAGGCAGTGGGCCAGATTTGG + Intronic
963081415 3:141398135-141398157 AACAGGTATCAGGCCAGATGTGG + Intronic
963287126 3:143444224-143444246 TCTAGGCATCTGGCCAATTTAGG - Intronic
964081226 3:152760461-152760483 AACAGGCAGCTGGGTAGATTTGG - Intergenic
965064601 3:163829960-163829982 TCCAGGCTTCTGGCCAATTTTGG + Intergenic
965119827 3:164540201-164540223 ACCATGCTTCTGCCAAGATTCGG - Intergenic
965604381 3:170484502-170484524 ACCAGTCATATGGCCAGATATGG + Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966384087 3:179376689-179376711 AGCTGGCAGCTGGCTAGATTTGG + Intronic
966954234 3:184857261-184857283 AACAGACGGCTGGCCAGATTTGG - Intronic
968443433 4:636171-636193 GCCTGCCATCTGGCCAGAGTGGG + Intronic
970108183 4:12608756-12608778 TACAAGCACCTGGCCAGATTTGG - Intergenic
972715493 4:41641894-41641916 AACTGGCTTCTGGCCACATTTGG + Intronic
973672336 4:53233651-53233673 GGTAGGCATATGGCCAGATTTGG - Intronic
974451323 4:62064810-62064832 AGGAGGCATCTTGCCAGATGCGG + Intronic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
976084146 4:81389926-81389948 AACAGGCAGCAGGCCAGACTTGG + Intergenic
976121328 4:81785594-81785616 AACAGGAAGCTGGCCACATTTGG + Intronic
976126260 4:81836552-81836574 AACAGGCAATCGGCCAGATTTGG + Intronic
979934705 4:126677031-126677053 AACAGGTAGCAGGCCAGATTTGG + Intergenic
980498706 4:133619573-133619595 ACCAGGAATGTGGCCATATGTGG - Intergenic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
984000738 4:174239981-174240003 AGCAGGCAGCAGGCCAGATCTGG - Intronic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
986341092 5:6790048-6790070 AACAGGCAACAGGTCAGATTTGG - Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
987285741 5:16454675-16454697 AACAGGCGGTTGGCCAGATTTGG - Intronic
987287431 5:16471073-16471095 AACAGGTAGCAGGCCAGATTTGG + Intergenic
988555583 5:32233137-32233159 AACAGGCGCCAGGCCAGATTTGG - Intronic
989112547 5:37920700-37920722 ACAAGGGATCTGGCCAGAGTAGG - Intergenic
990756530 5:59077984-59078006 ACCGCGCATCTGGTCAAATTTGG + Intronic
990980509 5:61598628-61598650 AGCAGGCAGCAGACCAGATTTGG - Intergenic
991345727 5:65665199-65665221 AAGAGGCAGCTGGGCAGATTTGG + Intronic
992243912 5:74797978-74798000 ACCAGGTGGCAGGCCAGATTTGG + Intronic
992594087 5:78328028-78328050 AACAGGCATTGGGCCAGATTTGG + Intergenic
993090167 5:83415801-83415823 AACAGGCTGCGGGCCAGATTTGG - Intergenic
993179796 5:84538030-84538052 TACAGGCATCTGACCATATTTGG - Intergenic
994900894 5:105767878-105767900 GACAGGCATCAGGCCAGATTTGG - Intergenic
995086484 5:108116820-108116842 ACAAGGCTGCTGGCCAGATTGGG - Intronic
995373733 5:111450495-111450517 AACAGACATGTGGCCAGATGCGG + Intronic
995539511 5:113170868-113170890 GCCAGCCATCTGGCAATATTTGG - Intronic
996892619 5:128440428-128440450 AGCAGGCACCTGGCCAGAGCAGG + Intronic
998852280 5:146362760-146362782 AACAGGCAGCAGGCCAGCTTTGG + Intergenic
1000003400 5:157161874-157161896 TCCAGGCAGCTGGTAAGATTTGG + Exonic
1000718269 5:164674522-164674544 AACAGACCTCTGGGCAGATTAGG - Intergenic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1001010379 5:168092333-168092355 AACAGGCAGTGGGCCAGATTAGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001709791 5:173769084-173769106 AACAGGCAAGGGGCCAGATTTGG - Intergenic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1004568710 6:16824137-16824159 AACAGGCAGCAGGCCAGAATTGG - Intergenic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1006187835 6:32190672-32190694 AGCTGGCCTCTGGCCAGACTGGG + Intergenic
1006202512 6:32308063-32308085 ACCAGGCAATTGGCCAGGTGCGG - Intronic
1007224630 6:40304272-40304294 AACAGGCATCGGGCTGGATTTGG + Intergenic
1007476909 6:42125068-42125090 ACCAGGCCTCTTGCCACTTTTGG - Intronic
1007757055 6:44106555-44106577 ACTGGGCATCTGGCCAGTGTGGG + Intergenic
1007835823 6:44672827-44672849 TCCAGGCATCTGGACAGATGTGG - Intergenic
1007941697 6:45787602-45787624 AACAGGCCGCTGGCCAGATGTGG + Intergenic
1009974424 6:70657893-70657915 ACTAGGCATGTGACCAAATTAGG - Intergenic
1010065854 6:71681714-71681736 AGCAAGCAGCTGGCCAGATTTGG + Intergenic
1010416082 6:75613149-75613171 AACAGGCAGCTGGACAAATTTGG - Intronic
1012305514 6:97652427-97652449 AACAAGCAACTGGCCAGGTTTGG + Intergenic
1012436679 6:99222413-99222435 GCCAGGCAGTGGGCCAGATTTGG + Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013745248 6:113337647-113337669 ACCAGGCAGCAGGCCAGATGTGG + Intergenic
1014652866 6:124062702-124062724 ACCAATAATCTGGCCAGATATGG - Intronic
1015126436 6:129760391-129760413 AGCAGGTGTCCGGCCAGATTTGG + Intergenic
1015170049 6:130242365-130242387 AACAGGCAGTAGGCCAGATTTGG + Intronic
1015283521 6:131459201-131459223 AACAGGCAGCAGACCAGATTTGG + Intergenic
1017440227 6:154457998-154458020 AACAGGCAGCTGGCAGGATTTGG - Intronic
1017442656 6:154478159-154478181 AGCAGGCCTCGGGCCAGCTTTGG - Intronic
1017631756 6:156402774-156402796 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1020884142 7:13801828-13801850 AACAGGCAGTTGGCCACATTTGG - Intergenic
1020912984 7:14156610-14156632 AACAGGCAGCTGGTCAGATTTGG + Intronic
1020925768 7:14322131-14322153 AACAGGCAGCAGGCCAGATCTGG - Intronic
1021348250 7:19554903-19554925 AACAGGCAGCTGACTAGATTTGG - Intergenic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1021674514 7:23066803-23066825 ACCAGTCATCTGGGAAGATTAGG - Intergenic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1022099819 7:27162251-27162273 GCCAGGCAGCTGGCCTGTTTGGG + Intergenic
1022270493 7:28802784-28802806 ATTAGGCAGCGGGCCAGATTTGG - Intronic
1023532046 7:41168074-41168096 AACAGGCATCAGGCTGGATTTGG - Intergenic
1024044376 7:45576773-45576795 CCCTGGCATCTGGTCAGATTGGG - Intronic
1025845571 7:65193500-65193522 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1025895790 7:65699213-65699235 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1026291053 7:69006515-69006537 AACGGGCATCAGGCCAGATTTGG - Intergenic
1027329523 7:77077267-77077289 AACAGGCCCCTGGCCAGATTTGG - Intergenic
1029011274 7:97264272-97264294 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1029051501 7:97693765-97693787 ACCAGGCAGTGGGCCAGATTTGG + Intergenic
1029786239 7:102794094-102794116 AACAGGCCCCTGGCCAGATTTGG + Intronic
1030797740 7:113809684-113809706 AACAGGCAACGGGCCAGATGGGG - Intergenic
1031048890 7:116925131-116925153 GCCACACATCTGGCCTGATTTGG - Intergenic
1032027438 7:128454921-128454943 ACCAGCCTTATGTCCAGATTTGG - Intergenic
1032865763 7:135922476-135922498 AACAGGCAATGGGCCAGATTCGG + Intergenic
1035491377 7:159281787-159281809 ACCAGTCATCAGGCCAGCTTTGG + Intergenic
1036214575 8:6868358-6868380 AACAGGCAGCAAGCCAGATTTGG - Intergenic
1036738335 8:11339474-11339496 AACAGGCAGCGGGCCAGATTTGG - Intergenic
1039265866 8:35823270-35823292 AACAGGTAGCTGGCTAGATTTGG + Intergenic
1041097991 8:54368349-54368371 ACCAGGTACCTGGTCAGCTTGGG - Intergenic
1041713188 8:60911277-60911299 CCCAGGGATCAGCCCAGATTGGG - Intergenic
1042330909 8:67579677-67579699 AACAGGCAGCAGGCCAGATATGG - Intronic
1044313240 8:90719529-90719551 AACAGGTAGCAGGCCAGATTTGG + Intronic
1044343808 8:91079333-91079355 ACAAGTCATATGGCCAGAATGGG + Intronic
1044387999 8:91612757-91612779 AGCAGGCAGTGGGCCAGATTTGG + Intergenic
1044977962 8:97684431-97684453 AACAGGCATCTGTCTGGATTTGG - Intronic
1047886115 8:129251739-129251761 ACCAGGCAGCAGGCTAGATTTGG - Intergenic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1051486456 9:17613905-17613927 ACCAGGCAGCTTGCCAAATAAGG - Intronic
1051608720 9:18941494-18941516 AACAGGCTGCTGGCCAGATCTGG + Intronic
1051677056 9:19569261-19569283 AACAGGCTGCAGGCCAGATTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1057198825 9:93129780-93129802 CCCAGGCAGCAGGCCACATTGGG + Intronic
1057552538 9:96062621-96062643 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1059319600 9:113458342-113458364 AACAGGCAGCCAGCCAGATTTGG + Intronic
1060421905 9:123475307-123475329 ACCACGCAACAGGCCAGATGCGG - Intronic
1060867756 9:127013446-127013468 ACCATGCTTCTGGCCTGACTGGG - Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1062217191 9:135395626-135395648 CCCAGGGCTCTGGCCAAATTAGG - Intergenic
1186157654 X:6742303-6742325 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1186546417 X:10454529-10454551 ACCAGGTAGCAGGCCAGGTTTGG + Intronic
1186592562 X:10946669-10946691 AGCAGGCAATGGGCCAGATTTGG + Intergenic
1186708674 X:12169926-12169948 AACAGGCAGTGGGCCAGATTTGG + Intronic
1186748105 X:12591514-12591536 AACAGGCAGAGGGCCAGATTTGG - Intronic
1187455814 X:19440376-19440398 ACGAGGCATCTGGCCAGAGCAGG - Intronic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1188530024 X:31129669-31129691 AACAGGTATTGGGCCAGATTTGG + Intronic
1189339717 X:40195564-40195586 AACAGGCAGCTGGCCAGATCTGG + Intergenic
1190755330 X:53396410-53396432 AGCAGGCAGCCTGCCAGATTTGG - Intronic
1192182562 X:68925369-68925391 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1195470217 X:105221235-105221257 ACCAGGCAGTTGGCATGATTTGG + Intronic
1198282412 X:135155045-135155067 TGCAGGCATCAGGCCAGAATTGG + Intergenic
1198287073 X:135201477-135201499 TGCAGGCATCAGGCCAGAATTGG + Intergenic
1198288547 X:135217477-135217499 TGCAGGCATCAGGCCAGAATTGG - Intergenic
1198802331 X:140460460-140460482 TCCTGGCATCTGGACACATTTGG - Intergenic
1201551207 Y:15218709-15218731 AGCAGGCAGTGGGCCAGATTTGG - Intergenic
1201580673 Y:15508803-15508825 ACCAGTCATCTATCCACATTAGG - Intergenic