ID: 1170188962

View in Genome Browser
Species Human (GRCh38)
Location 20:13625607-13625629
Sequence CTTTCTGACAGTCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170188962_1170188963 -9 Left 1170188962 20:13625607-13625629 CCTCTCTGCTGACTGTCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1170188963 20:13625621-13625643 GTCAGAAAGCCCCTGCCATTTGG 0: 1
1: 0
2: 0
3: 19
4: 131
1170188962_1170188964 -8 Left 1170188962 20:13625607-13625629 CCTCTCTGCTGACTGTCAGAAAG 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1170188964 20:13625622-13625644 TCAGAAAGCCCCTGCCATTTGGG 0: 1
1: 0
2: 2
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170188962 Original CRISPR CTTTCTGACAGTCAGCAGAG AGG (reversed) Intronic
902718707 1:18290278-18290300 CTTTCTGACCATGTGCAGAGGGG - Intronic
906787749 1:48630654-48630676 TTTTCTAACAGGCACCAGAGGGG + Intronic
910559788 1:88577997-88578019 CATTATGACAGGAAGCAGAGTGG + Intergenic
911165942 1:94724314-94724336 GTATCTGGCAGTCAGGAGAGGGG - Intergenic
912201196 1:107460322-107460344 CTTTCTGACAGTAAGAGCAGAGG - Intronic
923421358 1:233818632-233818654 TTTGCTGAGAGTGAGCAGAGTGG + Intergenic
924039447 1:239970115-239970137 TTTTCTGACACTGAGCAGGGAGG - Intergenic
924624480 1:245687770-245687792 CTTTCGGACAGGGGGCAGAGGGG - Exonic
1064185641 10:13159650-13159672 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1065810828 10:29441737-29441759 ATTTATGTCAGTGAGCAGAGGGG + Intergenic
1066979749 10:42401665-42401687 CTTCCTGAGAGTCAGTAGAATGG + Intergenic
1069777122 10:70933720-70933742 CTTCCTGAGAGGGAGCAGAGTGG - Intergenic
1070252386 10:74784371-74784393 ATTTCTCTCAGTGAGCAGAGGGG + Intergenic
1070505246 10:77107120-77107142 CTTTTTGACAGTCAGCCGTGTGG - Intronic
1070757824 10:79004460-79004482 CTTGATGACAGACAGCACAGTGG - Intergenic
1073230717 10:101967380-101967402 CTCACTGTCAATCAGCAGAGTGG + Intronic
1074206973 10:111291192-111291214 CTTTCTGAGTGCCCGCAGAGGGG + Intergenic
1075411199 10:122229327-122229349 CTGTCTGAAAGCCGGCAGAGAGG - Exonic
1075971605 10:126659026-126659048 ATATCTGACAGCCAGCACAGTGG + Intronic
1076261226 10:129068663-129068685 CTTCCTCAAAGCCAGCAGAGAGG + Intergenic
1076862150 10:133142986-133143008 CTTTCTGACTGGCTGCAAAGTGG + Intergenic
1077290967 11:1792670-1792692 CGTTATGACAGGAAGCAGAGTGG + Intergenic
1078165717 11:8882430-8882452 CAATCTGGCAGTCAGCAGATTGG - Intronic
1079029395 11:16974874-16974896 CGTTATGACAGGAAGCAGAGTGG - Intronic
1079507699 11:21172501-21172523 TTTTCTCAAAGTCAGCAAAGGGG - Intronic
1079732639 11:23954167-23954189 CTTTCAGATAGACAGCAGATGGG - Intergenic
1081558900 11:44194117-44194139 CTTTATGACATTAAGAAGAGAGG - Intronic
1082990430 11:59202609-59202631 CCATCTGAGAGTCAACAGAGTGG + Intronic
1088554152 11:111044747-111044769 CCTTCCTACAGTCAGCAGAAGGG + Intergenic
1089564111 11:119361882-119361904 CTTACTGACAGTCAGCAAGAGGG + Intronic
1091011962 11:132009553-132009575 CTTTCTGACAGTCCTGAGAATGG + Intronic
1091274555 11:134341824-134341846 CTCTGTGACACTCAGCTGAGGGG + Intronic
1092530168 12:9337380-9337402 CTTTCTGGCTGTCAGGAGGGCGG + Intergenic
1096243060 12:49969640-49969662 CTCTCTGACAGTGAGTGGAGAGG + Intronic
1096510919 12:52127850-52127872 CTTCCTCACTGTGAGCAGAGGGG + Intergenic
1097019861 12:56012683-56012705 CTCCCTGACAGGCAGCAGTGAGG - Intronic
1097479997 12:60111816-60111838 CTTTCTGACTTTTAGCAGATAGG + Intergenic
1103404941 12:120668488-120668510 CTTCCTCCCACTCAGCAGAGAGG - Intergenic
1104497369 12:129253580-129253602 ATTTCTGACACTGAGCAAAGGGG + Intronic
1104566039 12:129884866-129884888 CTATCTGAAAGACACCAGAGTGG - Intronic
1107839471 13:44440905-44440927 TTTTCTGACTGCCAGCAAAGTGG - Intronic
1108463694 13:50693540-50693562 CTTCCTGACAGTTTACAGAGAGG - Intronic
1111431590 13:88153022-88153044 CTCTCTGACAGGCAGCCCAGTGG - Intergenic
1111455695 13:88481025-88481047 CTTTCTGAGGCTCAGCACAGGGG - Intergenic
1113478429 13:110602341-110602363 ATTTATCTCAGTCAGCAGAGGGG - Intergenic
1120021814 14:79539386-79539408 GGTTCTGAGAGTCAACAGAGAGG - Intronic
1120353744 14:83400872-83400894 CTTTCTGGCATTCTTCAGAGTGG - Intergenic
1121105979 14:91280011-91280033 CTTCCTGAAAGTCTGCAGTGGGG - Intronic
1122225926 14:100279568-100279590 GTATCTGGCAGTCAGGAGAGAGG + Exonic
1122922398 14:104885419-104885441 CTTTCGCCCAGTCATCAGAGGGG + Exonic
1125016574 15:34943197-34943219 CGTTATGACAGGAAGCAGAGTGG + Intronic
1127651127 15:61008864-61008886 CTTGGTCAGAGTCAGCAGAGAGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1131100733 15:89688112-89688134 CATTATGACAGGAAGCAGAGTGG - Intronic
1131615373 15:94011796-94011818 CTTTCTGACGCTCTGGAGAGGGG - Intergenic
1132179017 15:99737623-99737645 CTTTATTCCAGGCAGCAGAGAGG - Intergenic
1133189605 16:4123845-4123867 CTTGCTGCCACTCAGCTGAGAGG + Intergenic
1133690326 16:8208113-8208135 TTAGCTGACAGTCAGCTGAGAGG - Intergenic
1133697969 16:8282862-8282884 ATTTCAGACTGTCAGCAAAGTGG - Intergenic
1133826355 16:9281703-9281725 CTTTCAGAAAACCAGCAGAGAGG - Intergenic
1135037979 16:19094262-19094284 CAGTGTGACTGTCAGCAGAGAGG + Intergenic
1138018729 16:53456905-53456927 CTGTCTGACAGTAAGTAGGGAGG + Intronic
1139199397 16:64957303-64957325 TTTTCCAACAGTCTGCAGAGAGG - Intronic
1140049712 16:71469568-71469590 CTATCTGCCAGTCAGCAGCCAGG - Intronic
1140488332 16:75312724-75312746 CTCCCTGACAGTCAGCTGAGAGG - Intronic
1141756278 16:85993245-85993267 CTTCCTGACAGACAGCAAAAAGG - Intergenic
1144519297 17:15943875-15943897 TTTGCTGACAGTCACCAAAGAGG - Intergenic
1144947058 17:18974925-18974947 CTATCTGACAGTCAGGGGTGGGG + Intronic
1147178350 17:38670483-38670505 CCTTGTGACAGACAGGAGAGGGG + Intergenic
1147325034 17:39666027-39666049 CTTGCTGACAGGCACCACAGGGG - Exonic
1147644386 17:42025109-42025131 CCTGCTGTCAGTCACCAGAGTGG + Exonic
1151586470 17:75011884-75011906 CTTTCTTCCAGCCAGGAGAGAGG - Intergenic
1151634806 17:75338944-75338966 CGTTATGACAGGAAGCAGAGTGG + Intronic
1154181333 18:12142335-12142357 CTGTCTGGTAGTGAGCAGAGGGG + Intergenic
1154182571 18:12149249-12149271 CTGTCTGGTAGTGAGCAGAGGGG - Intergenic
1154333230 18:13446905-13446927 CCTTCTGGCATTCAGCAGATTGG + Intronic
1155498691 18:26466119-26466141 CTTTCTCAGAGAAAGCAGAGTGG - Intronic
1155714368 18:28922030-28922052 ACTTCTGACACTCAGTAGAGAGG + Intergenic
1157508582 18:48250733-48250755 CTGACTGACAGTCAGCTGAGTGG - Intronic
1157984683 18:52423570-52423592 CATTCTGTCAGTAGGCAGAGAGG + Intronic
1158233093 18:55280579-55280601 CTTTCTGACCATCTGGAGAGAGG - Intronic
1158940276 18:62401252-62401274 CTAGCTGAAAGTCAGCACAGTGG + Intergenic
1159017071 18:63110077-63110099 TTTTCTGACAGTCAAGAGGGAGG + Intergenic
1159046811 18:63376492-63376514 CTTGCTGGCTGTCAGCTGAGAGG - Intergenic
1159420023 18:68206051-68206073 CCTTCTAACTGGCAGCAGAGGGG + Intergenic
1160341652 18:78094455-78094477 CTTTATGCCAGCCAGCAGTGAGG + Intergenic
1162219987 19:9168136-9168158 CTTTCTGCCATTCAGCACAACGG + Intergenic
1164576475 19:29408210-29408232 CTTTCTGGCAGTCACAGGAGTGG - Intergenic
1164968245 19:32506316-32506338 CTATATGAATGTCAGCAGAGTGG + Intergenic
1167094279 19:47365748-47365770 CCTTCTTCCAGTCACCAGAGAGG + Intronic
1167129713 19:47576336-47576358 CCTTTTGAAAGACAGCAGAGAGG + Intergenic
1168336799 19:55601643-55601665 ACTTCTGCCAGTCAGCAGGGAGG + Intronic
925036277 2:688884-688906 CCTTCTGACAGGCAGCACTGTGG + Intergenic
925681216 2:6423406-6423428 CTCTCTGACAGTCATGACAGAGG - Intergenic
925870992 2:8270457-8270479 CTTTCAAACAGCCAGCACAGAGG + Intergenic
925997808 2:9306412-9306434 CTTTCTTAAAGGCAGAAGAGCGG + Intronic
926214911 2:10899910-10899932 ATTTTTGACAGCCAGAAGAGTGG - Intergenic
926302255 2:11612797-11612819 CTTTCTGAGAATCAGGAGAAGGG - Intronic
926332735 2:11838549-11838571 CATTCTGAAACTCTGCAGAGTGG - Intergenic
926828386 2:16932780-16932802 CATTTTGACAGTCAGAAAAGGGG - Intergenic
927487486 2:23498513-23498535 CTTCCTGAGCCTCAGCAGAGGGG - Intronic
928834629 2:35529302-35529324 CTTTATCTCAGTGAGCAGAGGGG + Intergenic
929535657 2:42782670-42782692 ATTTATGCCAGTGAGCAGAGGGG - Intronic
930305797 2:49673101-49673123 CTTGCTGACTGTCAGTGGAGGGG + Intergenic
931159295 2:59670887-59670909 CTATCTGAAAGTCACCTGAGAGG - Intergenic
931983981 2:67723723-67723745 CTTTATGACAGCCAGAAAAGTGG - Intergenic
932175240 2:69594922-69594944 CGTTATGACAGGAAGCAGAGTGG - Intronic
932416297 2:71575573-71575595 CTTTCTGACTCAAAGCAGAGGGG - Intronic
932418760 2:71589091-71589113 CTTGCTCACCCTCAGCAGAGTGG + Intronic
932984954 2:76714668-76714690 CTGTGAGACAGTCAGCAAAGTGG + Intergenic
934108941 2:88724012-88724034 ATTTATCACAGTGAGCAGAGGGG + Intronic
935075810 2:99742613-99742635 CTTTCTGGGAATCAACAGAGTGG + Intronic
936271303 2:111051379-111051401 ATTTCAGACAGTCTGCAAAGTGG - Intronic
936477157 2:112849213-112849235 ATTTATCACAGTGAGCAGAGGGG - Intergenic
936945126 2:117923240-117923262 CTTTCTGACACTCCCCAGTGAGG - Intronic
938909181 2:135870178-135870200 TTTTCTGACTGTCAGCTAAGTGG + Intronic
939713047 2:145547158-145547180 TTTACTGAGAGGCAGCAGAGTGG + Intergenic
941467048 2:165840298-165840320 CTTTCTGTGAGTCAGGAGACTGG - Intergenic
942937056 2:181570125-181570147 CTTTTTGTAAGTCAGCACAGAGG + Intronic
943909165 2:193541217-193541239 CTTTCTGACAGGCTTCAGAGTGG - Intergenic
944376803 2:199054828-199054850 GATTCTGAGAGCCAGCAGAGAGG + Intergenic
945044049 2:205766319-205766341 GTTGCTTTCAGTCAGCAGAGTGG + Intronic
946701230 2:222416304-222416326 ATTTATCTCAGTCAGCAGAGGGG - Intergenic
946864074 2:224027186-224027208 CTTTCAGACAGCCAGCAGGGGGG - Intronic
948455210 2:238101605-238101627 CTTTCTGACCATGAGCAGAGTGG + Intronic
1169377897 20:5081761-5081783 CTTTCTGACAGCAAGCAGGGAGG - Intronic
1169477157 20:5941959-5941981 GTTTCTTTCACTCAGCAGAGCGG + Exonic
1170188962 20:13625607-13625629 CTTTCTGACAGTCAGCAGAGAGG - Intronic
1172783813 20:37452633-37452655 CTCTCTGAGTGTCAGCACAGAGG + Intergenic
1172832453 20:37847630-37847652 CTTTCTGACAGTCAAAAGCCAGG - Intronic
1172854349 20:37990058-37990080 CTTCCTGACAGACAGCAAAGAGG - Intronic
1173257003 20:41400881-41400903 CCTCCTGAAAGCCAGCAGAGAGG - Intergenic
1173427142 20:42953187-42953209 TATCCTGAGAGTCAGCAGAGGGG + Intronic
1174473168 20:50776490-50776512 CTCCCTGACAGTCTCCAGAGAGG - Intergenic
1178399430 21:32272307-32272329 CTTGCTGACCATCAGCAGAAAGG + Intronic
1179151163 21:38809502-38809524 CTTTCTTACAGCCTGGAGAGTGG + Intronic
1181358559 22:22317705-22317727 GTTTCTCTCAGTGAGCAGAGGGG + Intergenic
1182134494 22:27888663-27888685 GCTTCTGAAATTCAGCAGAGAGG + Intronic
1182486375 22:30641438-30641460 CTGTCTGGCAGGCAGCAGACAGG - Intronic
1183890751 22:40926372-40926394 CTTTGGGACAGTCTGCAGAAAGG - Exonic
1184527317 22:45032603-45032625 CTTTCTGACAGGCTGCAGGTGGG + Intergenic
1184660401 22:45963020-45963042 CTGTCTTGCAGTCTGCAGAGAGG - Intronic
950581807 3:13867195-13867217 CTTTCTGACAGTCTGCAGAATGG - Intronic
952589637 3:34934844-34934866 TTTTCTGCCTGACAGCAGAGGGG + Intergenic
952662819 3:35872004-35872026 CGTTCTAACAGGAAGCAGAGTGG + Intergenic
955250652 3:57278867-57278889 CTTGCTGCCATTAAGCAGAGTGG - Exonic
956775354 3:72560835-72560857 CTTTCTGAAAAACAGAAGAGAGG + Intergenic
958134994 3:89477343-89477365 CCCTTTGACAGTCAGCAGGGAGG + Intronic
958711930 3:97727257-97727279 CTTTCTGAAACTCACCTGAGGGG + Intronic
960305315 3:116053203-116053225 ATTTCTGACACTAAGCAGAGAGG - Intronic
961601962 3:128069350-128069372 CTTTCTAGGAGACAGCAGAGGGG + Intronic
964418104 3:156471223-156471245 ATTCCAGACAGTCAGCAGATTGG - Intronic
966676559 3:182596354-182596376 CCTGCTGATAGTGAGCAGAGTGG + Intergenic
967328651 3:188267900-188267922 CGTTCTTACACTCAGCTGAGTGG + Intronic
967557304 3:190875244-190875266 CCTTCTTCCAGTCACCAGAGAGG + Intronic
967845806 3:194041766-194041788 CTTTCTGACATTCAGGAAAGAGG - Intergenic
969474271 4:7412391-7412413 CTTTCTGACAGTGTGCAGGGGGG + Intronic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
970483822 4:16504632-16504654 CTTTCTGCCAGTCAGAAGGACGG - Intronic
971102238 4:23480526-23480548 CTTATTTACTGTCAGCAGAGAGG - Intergenic
974936416 4:68414053-68414075 CATCCTGTCAGTCAGCAGGGTGG - Intergenic
975826267 4:78322335-78322357 CTTTTTAACATTCTGCAGAGAGG - Intronic
978334116 4:107647465-107647487 TTTTATGTCAGTCAGTAGAGAGG - Intronic
978693888 4:111551970-111551992 CGTTATGACAGGAAGCAGAGTGG + Intergenic
978710695 4:111777061-111777083 CTTCATGACAATCAGAAGAGAGG - Intergenic
980244000 4:130214059-130214081 CTCTCTATCAGACAGCAGAGAGG - Intergenic
981132709 4:141175841-141175863 TCTTGTGACAGACAGCAGAGAGG + Intronic
982175880 4:152705022-152705044 CTTAGTGACAGGCAGCAGATTGG - Intronic
982322270 4:154089916-154089938 CTCTCTGACAATTAGAAGAGAGG + Intergenic
984710146 4:182878036-182878058 CTTGGTGAAAGTCAGCAGAAGGG - Intergenic
985037219 4:185852703-185852725 CTTTCTAATATTCAGTAGAGCGG + Intronic
988727625 5:33939786-33939808 CTCTATGAAAGCCAGCAGAGGGG - Intergenic
989537928 5:42585233-42585255 CTTTCTGATACTCAGCTCAGAGG + Intronic
990690470 5:58358302-58358324 CTTTCTCACAGTAAGAAGAATGG + Intergenic
991611132 5:68450736-68450758 GCTGCTGACAGTAAGCAGAGAGG + Intergenic
996117492 5:119634292-119634314 CTGTCTGACAGTGAGCCCAGTGG + Exonic
996864241 5:128101599-128101621 GTTAATGACAGCCAGCAGAGTGG - Intronic
997653830 5:135540964-135540986 GTTTCTGATAACCAGCAGAGAGG - Intergenic
998036157 5:138918400-138918422 ATTTCTGAGAGACAGAAGAGAGG - Intronic
998853750 5:146375285-146375307 CTAGCTGACAGACAGCAGAGGGG + Intergenic
1000174164 5:158734482-158734504 CTCTCTGAAAATCAACAGAGAGG + Intronic
1000474040 5:161683154-161683176 ATTTCTGACAATCTGCAGAATGG + Intronic
1000607207 5:163337927-163337949 CTTTCTGAGAGGCAGTGGAGTGG - Intergenic
1001307323 5:170584914-170584936 CTTCATGACAGTCATCAGTGTGG + Intronic
1003052545 6:2793034-2793056 CTTCCTGAGAGTCAGCAGGATGG + Intergenic
1004955299 6:20722517-20722539 CATTATGACAGGAAGCAGAGTGG - Intronic
1006063015 6:31439756-31439778 CTTTCTTGCAGTGAGCACAGAGG + Intergenic
1009359578 6:62795283-62795305 CTTTCTGAGAGTTAGTGGAGTGG - Intergenic
1012030534 6:94055029-94055051 CTTTCTGAAAGAAAGGAGAGTGG + Intergenic
1013938699 6:115633440-115633462 GTATATGACAGTCAGCAAAGTGG + Intergenic
1015427897 6:133093436-133093458 CTTTGAGACAGTCAAAAGAGAGG - Intergenic
1017605692 6:156129894-156129916 CAGTCTGGAAGTCAGCAGAGGGG - Intergenic
1017718803 6:157230709-157230731 CTTGCTTTCAGTCTGCAGAGTGG + Intergenic
1018214334 6:161512518-161512540 ATTTCTCACGGTCAACAGAGCGG + Intronic
1018304194 6:162437500-162437522 CATTGTTACAGTCAGCACAGAGG + Intronic
1018813512 6:167314645-167314667 ATTTCTCTCAGTGAGCAGAGGGG - Intronic
1020061668 7:5157093-5157115 CATGGTGACAGCCAGCAGAGTGG - Intergenic
1021028620 7:15701613-15701635 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1022757731 7:33311521-33311543 CTTTCTAACAGTAAGCAAGGTGG - Intronic
1023283766 7:38597085-38597107 CTTTTTGATAGTCAGCTCAGAGG - Intronic
1027931954 7:84548396-84548418 ATTTCTGACATTCAGGTGAGAGG + Intergenic
1028085833 7:86636069-86636091 CTTTCTTACAGTTTGCAGGGAGG - Intergenic
1029615582 7:101654964-101654986 CTTTATCTCAGTGAGCAGAGGGG + Intergenic
1030079834 7:105767777-105767799 CTATCGGAGAGGCAGCAGAGGGG - Intronic
1033462113 7:141556219-141556241 ATTTATGTCAGTGAGCAGAGGGG + Intronic
1033761527 7:144441349-144441371 CTTCCTGACTGTTAGCACAGTGG - Intergenic
1034187605 7:149191084-149191106 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1034388696 7:150764676-150764698 CTTTCTGACAATGAGAAAAGTGG - Intergenic
1034850730 7:154491048-154491070 CTTTCTGGCTGACATCAGAGGGG + Intronic
1039251633 8:35671720-35671742 CTTTGTGTCTGTCAGCTGAGGGG + Intronic
1039448888 8:37655358-37655380 AATTCTGAAAGTGAGCAGAGAGG + Intergenic
1039494540 8:37970995-37971017 ATTTTTGATGGTCAGCAGAGGGG + Intergenic
1040344305 8:46472900-46472922 CTTTCTGACATTCATCAGGTTGG - Intergenic
1040346291 8:46500894-46500916 TTTTCTCACATTCAGCAGATTGG - Intergenic
1040346745 8:46509211-46509233 CTTTCTCACATTCAGCAGGTTGG - Intergenic
1042750633 8:72154031-72154053 TTTCCTGACTGTCAGCAGTGTGG + Intergenic
1043527593 8:81112792-81112814 CTGTCTGACAGTCACCCGAGGGG + Intergenic
1043924076 8:86016936-86016958 CGTTATGACAGAAAGCAGAGTGG + Intronic
1044361878 8:91295249-91295271 CTTTATGCCAATCTGCAGAGAGG + Intronic
1046919968 8:119717582-119717604 CTTTATCTCAGTGAGCAGAGAGG - Intergenic
1049131568 8:140849268-140849290 CTTTCTCTCTGGCAGCAGAGGGG - Intronic
1049374567 8:142282936-142282958 CTGTCTGTCAATGAGCAGAGGGG + Intronic
1049386639 8:142346055-142346077 CTTGCTGGCATTCAGCAGAAGGG - Intronic
1050560461 9:6829648-6829670 CTTTCAGACAGTCACCAGGAAGG + Intronic
1051864465 9:21663871-21663893 CCTTCTAAGAGTCAGCAGAATGG - Intergenic
1059724963 9:116998713-116998735 CTTTCTGGCAGACTGTAGAGGGG - Intronic
1060936969 9:127521639-127521661 CTTTCTCACAGTCCGCAGGGTGG + Intronic
1187729583 X:22238843-22238865 CTGCCTGACAGCCAGCACAGCGG + Intronic
1188133151 X:26462779-26462801 CTTTTTGAAAGTGAGCAGAAAGG - Intergenic
1190036620 X:47031213-47031235 CTTTCAGACTGGCAGAAGAGAGG - Intronic
1191049719 X:56178117-56178139 CTTTCTGACACTCCGCAGTGAGG + Intergenic
1191672878 X:63765296-63765318 CTTTCTGAGAAGCAGCTGAGGGG - Intronic
1192312227 X:70026653-70026675 CTTCCTAACAGTGAGCAGTGAGG + Intronic
1192989267 X:76431374-76431396 CTTTCATACAGTGAGCACAGTGG + Intergenic
1194419251 X:93651771-93651793 ATTTCTGAGAAACAGCAGAGAGG - Intergenic
1195083454 X:101391763-101391785 CGTTATGACAGGAAGCAGAGTGG + Exonic
1197347128 X:125337441-125337463 ATTTATCACAGTGAGCAGAGGGG + Intergenic
1198963552 X:142205664-142205686 CATTTTGAGAGTCAGCAGAAGGG - Intergenic
1199203032 X:145115661-145115683 GTATCTGACACTCAGTAGAGAGG + Intergenic
1199641497 X:149866826-149866848 CCTCCTGACAGTCATAAGAGTGG + Intergenic
1199817668 X:151413147-151413169 CTGTCTTAAAGTCAGCTGAGAGG - Intergenic
1202062297 Y:20900160-20900182 CTTTCTGAGAGCTAGTAGAGGGG - Intergenic