ID: 1170191635

View in Genome Browser
Species Human (GRCh38)
Location 20:13650691-13650713
Sequence CTGTTGTTATTGGGAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170191635_1170191642 30 Left 1170191635 20:13650691-13650713 CCTTTTGTTCCCAATAACAACAG No data
Right 1170191642 20:13650744-13650766 TCCATTTTATGTGGCTTTGCTGG No data
1170191635_1170191639 -8 Left 1170191635 20:13650691-13650713 CCTTTTGTTCCCAATAACAACAG No data
Right 1170191639 20:13650706-13650728 AACAACAGTCACTTGGACCATGG No data
1170191635_1170191641 21 Left 1170191635 20:13650691-13650713 CCTTTTGTTCCCAATAACAACAG No data
Right 1170191641 20:13650735-13650757 ATCTGCATCTCCATTTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170191635 Original CRISPR CTGTTGTTATTGGGAACAAA AGG (reversed) Intergenic
No off target data available for this crispr